1 / 63

Chromosome abnormalities

Chromosome abnormalities. Dr Cédric Le Caignec Service de Génétique Médicale CHU Nantes. Genetic anomalies. 1. Chromosome abnormalities or rearrangements 2. Gene defects: mutations. ATGCACTGATGAATGCATGCAAT. From 1 b to 1000 b. Molecular level. A gene: about 20 kb. Level of resolution.

joshua-mercer
Télécharger la présentation

Chromosome abnormalities

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Chromosome abnormalities Dr Cédric Le Caignec Service de Génétique Médicale CHU Nantes

  2. Genetic anomalies 1. Chromosome abnormalities or rearrangements 2. Gene defects: mutations

  3. ATGCACTGATGAATGCATGCAAT From 1 b to 1000 b • Molecular level A gene: about 20 kb Level of resolution Chromosomal band: 5-10 Mb • Cytogenetic level Genome: 3x109 bases

  4. 22 11 Chromosome abnormalities • Different types • Balanced anomalies: associated with a normal phenotype for the majority

  5. Chromosome abnormalities • Different types • Balanced anomalies: associated with a normal phenotype for the majority • Unbalanced anomalies: with a gain or a loss of genetic material usually with abnormal phenotype

  6. Chromosome abnormalities At birth 0.6 à 0.9% of the newborns carry a chromosomal anomaly  high pressure of selection during fetal development Third trimester miscarriages: 5% of the fetuses carry a chromosomal anomaly First trimester miscarriages: 60% of the fetuses carry a chromosomal anomaly

  7. Chromosome abnormalities • Constitutional / Acquired • Homogeneous / Mosaic

  8. Meiosis Fecundation Mitosis Birth

  9. Chromosome abnormalities • Constitutional / Acquired • Homogeneous / Mosaic • Numerical / structural • Balanced • Unbalanced

  10. Numerical abnormalities

  11. Numerical abnormalities :the ploidy • Diploidy (normal somatic cell) : 2 haploïd sets of chromosomes

  12. Numerical abnormalities : the ploidy • Diploidy (normal somatic cell) : 2 haploïd sets of chromosomes • Polyploidy : more than 2 haploïd sets of chromosomes (ex: triploidy)

  13. Numerical abnormalities : polyploidy • Anomaly at fecundation • Triploidy : 69,XXX or 69,XXY or 69,XYY • Tetraploidy : 92,XXYY or 92,XXXX (hemopathies, tumors)

  14. Numerical abnormalities :example of a triploid cell 69,XXX

  15. Numerical abnormalities : • Diploidy (normal somatic cell) : 2 haploïd chromosome sets • Polyploidy : more than 2 haploïd chromosome sets (ex: triploidy) • Aneuploidy: • Gain of one (or more) chromosome (trisomy) • Loss of one (or more) chromosome (monosomy)

  16. Numerical abnormalities :example of trisomy 21 (autosome)

  17. Numerical abnormalities :example of monosomy X

  18. Mechanisms of the aneuploidies • Non-disjunction in meiosis • First division in meiosis I • Second division in meiosis II • Post-zygotic mitotic non-disjunction

  19. MI MII Mechanisms of the aneuploidies: meiosis I non disjunction Most often: homogeneous anomaly

  20. Mechanisms of the aneuploidies: meiosis II non disjunction Most often: homogeneous anomaly MI MII

  21. Mechanisms of the aneuploidies • Non-disjunction in meiosis • First division in meiosis I • Second division in meiosis II • Post-zygotic non-disjunction in mitosis

  22. Mechanisms of the aneuploidies: post-zygotic non-disjunction in mitosis Zygote (post Fecundation) Most often: mosaics

  23. Aneuploidies mat MI MII pat Trisomy 21 91% 75% Trisomy 18 93% 60% Trisomy 13 88% 45,X 80% 47,XXY 53%47%

  24. STRUCTURAL ANOMALIES

  25. Structural anomalies • Balanced ---> Normal phenotype but risk to future offspring • Unbalanced • Deletion • Duplication • Derived chromosome ---> usually associated with abnormal phenotype

  26. Structural anomalies • Only one chromosome involved • One breakage: terminal deletion • Two breakages: one arm: interstitial deletion paracentric inversion two arms: pericentric inversion ring chromosome isochromosome • Two chromosomes involved • Robertsonian translocation • Reciprocal translocation

  27. Structural anomalies • Only one chromosome involved • One breakage: terminal deletion

  28. neotelomere loss breakage Terminal deletions (del) One breakage: terminal deletion del(4)(p15.3)

  29. Terminal deletions (del) • 4p deletion • 5p deletion : Cri du chat syndrome

  30. Structural anomalies • Only one chromosome involved • One breakage: terminal deletion • Two breakages: one arm: interstitial deletion

  31. loss of the chromosome region between Two breakpoints Interstitial deletions Two breakpoints on the same chromosome arm and loss of the chromosome region between: interstitial deletion

  32. Anomalies de structure • Only one chromosome involved • One breakage: terminal deletion • Two breakages: one arm: interstitial deletion • paracentric inversion • two arms: pericentric inversion ring chromosome • isochromosome • Two chromosome involved • Robertsonian translocation: centric fusion

  33. Robertsonian translocations • Involve two acrocentric chromosomes • Breakpoints located at the centromere or close to • Loss of the short arms • Loss of a centromere • Karyotype with 45chromosomes • Consequences in meiosis

  34. loss fusion Robertsonian translocations (rob ou der) rob(13;14)(q10;q10) ou der(13;14)(q10;q10) normal phenotype but clinical consequences

  35. 45,XX,rob(14;21)(q10;q10) Loss of the short arm(s) of chromosomes 14 and 21 Normal phenotype

  36. Risk to future offspring ? der (14;21)(q10;q10) Trisomy 14 ? Trisomy 21 ? 50 % ? 14 21

  37. pachytene

  38. normal balanced • pachytene • alternate segregation gametes zygotes balanced normal

  39. gametes disomy 21 nullosomy 21 zygotes trisomy 21 monosomy 21 miscarriage • adjacent segregation

  40. 46,XY,der(14;21)(q10;q10),+21 trisomy21

  41. gametes disomy 14 nullosomy 14 zygotes trisomy 14 monosomy 14 miscarriage miscarriage • adjacent segregation

  42. Genetic counseling • der(14;21)(q10q10) • the majority of the familial trisomy 21 (1/2 de novo ; 1/2 inherited) • different risk when maternally or paternally inherited • Maternally inherited : trisomy 21 risk: 15 % • Paternally inherited : trisomy 21 risk : 2 %

  43. Genetic counseling • der(21;21)(q10;q10) • Rarely inherited • When inherited: 100% risk of trisomy 21 in the offspring

  44. Genetic counseling • der(13;14)(q10;q10) • frequent (~ 1/1200) • low risk: trisomy 13 ( ~ 1%)

  45. 45,XY,der(13;14)(q10:q10)

  46. Structural anomalies • Only one chromosome involved • One breakage: terminal deletion • Two breakages: one arm: interstitial deletion paracentric inversion two arms: pericentric inversion ring chromosome isochromosome • Two chromosome involved • Robertsonian translocation • Reciprocal translocation

  47. fusion Translocations (t) Two breakpoints located on two different chromosomes followed by an exchange: reciprocal translocation t(6;18)(p24;q21.2)

  48. Breakpoint anomaly Reciprocal translocations • Normal phenotype when balanced • When abnormal phenotype (rarely): • Gene interrupted at one of the breakpoint • microdeletion or • microduplication

  49. 46,XX,t(11;22)(q23.3;q11.2)

  50. Reciprocal translocations t (11;22)(q23.3;q11.2) 11 22

More Related