1 / 1

- cloned from the anterior horn tissues

Primer S2. (A). (B). AGAAGCTGGAAGAGTCAAAG GACACATTCTCCCCTCAAGC CCCAGTGGGA. AGAAGCTGGAAGAGTCAAAG GACACATTCTCCCCTCAAGC CCCAGTGGGA. Breast (C).

Télécharger la présentation

- cloned from the anterior horn tissues

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Primer S2 (A) (B) AGAAGCTGGAAGAGTCAAAGGACACATTCTCCCCTCAAGCCCCAGTGGGA AGAAGCTGGAAGAGTCAAAGGACACATTCTCCCCTCAAGCCCCAGTGGGA Breast (C) CCCCACAAAA GATATGTTCA TGTCCTAATC CCCAGAATCT GCAAATGTTA TTTGGAAAAA GGGGTTTTGC AGATGTAATT AAGTTAAGAA TCTTGAGATAAGATCATCCT GGATTATCCA GGTAGCCTCA AAATCAAGTG ACAAGTGTCT TTGTAAGGGA CAAGTAGACC CATTACAGAG AAGACGACGC GCAGAAAAGG AGGAAGCAGT GTGCTCATGG AGGCGGAGAT TGGAGTGATG TAACCGCAAG CCGAGGAATG CTTATAGTCA CCAGAAGCTG GAAGAGTCAA AGGACACATT CTCCCCTCAA GCCCCAGTGG GAGCACGGCC CAGCTGGATT TTGGACTTCT GGCCTCCAGA ACTGTAAGAG AAATGTCCAT TGTCTTAAGC CAACCAGTTT GTGGTAGTTT GTTACAGCAG CCCCAGGAAA CTACTA . Breast (N) GCACGGCCCAGCTGGATTTTGGACTTCTGGCCTCCAGAACTAGACAGGGC Marker GATA-1 GCACGGCCCAGCTGGATTTTGGACTTCTGGCCTCCAGAACTAGACAGGGC Reverse CTCACTGTGTCACCCAGGGTGGAATACAGTGGTGTGATCATAGCTCACTG CTCACTGTGTCACCCAGGGTGGAATACAGTGGTGTGATCATAGCTCACTG GATA-2 AluJ element Cos7 HCT116 CAGCCTGGAATTCCTGGGCTCAAGCAACCCTGCCACCTCAGCCTTCCAAG CAGCCTGGAATTCCTGGGCTCAAGCAACCCTGCCACCTCAGCCTTCCAAG Forward Nkx2-5 Nkx2-5 1 556 bp TAGCTAGGACTACAGAACATCCATGATAGCAGTCTTCTGTAAATCGAACT TAGCTAGGACTACAGAACATCCATGATAGCAGTCTTCTGTAAATCGAACT 2 430 bp 3 315 bp TTTCAAGAATTCTCTGAAGGAACCAAGTAGGATATTCTTACATCATGACT Reverse TTTCAAGAATTCTCTGAAGGAACCAAGTAGGATATTCTTACATCATGACT Whn ELF-1 G I I M E E E Q K Y N Q S F TAATGTGAATGCAAGAACAAGAAATAGGTTTTATCTCTAAATATAATGAA (C) TAATGTGAATGCAAGAACAAGAAATAGGTTTTATCTCTAAATATAATGAA +1 TRANSCRIPTION START SITE P I D G T S I V N L V S L L T C D 1 2 3 11 Forward GGGCTGTGTGTAAACACTGACCCTGTCTCAATTCTAACAAGCATTTTAGA AluJ MaLR GGGCTGTGTGTAAACACTGACCCTGTCTCAATTCTAACAAGCATTTTAGA MaLR-derived promoter transcript (556 bp) 1) Q R H R S D Q S S S L M D G L M CATGAGTTTACATCGGCAAATGGGTTCAGATCGAGATCTTCAGTCCTCTG CATGAGTTTACATCGGCAAATGGGTTCAGATCGAGATCTTCAGTCCTCTG Control 1 2 10 M S L H R Q M G S D R D L Q S S MaLR-derived promoter transcript (430 bp) AluJ MaLR 2) A S S V S L P S V K K A P K K R R CTTCATCTGTGAGCTTGCCTTCAGTCAAAAAGGCACCCAAAAAAAGAAGA CTTCATCTGTGAGCTTGCCTTCAGTCAAAAAGGCACCCAAAAAAAGAAGA A S S V S L P S V K K A P K K R R 0 2 4 6 8 10 12 14 16 18 20 22 R I S I G S L F R K K D N K R K S ATTTCAATAGGCTCCCTGTTTCGGAGGAAAAAAGATAACAAACGTAAATC 1 2 11 3 Relative Luciferase Activity (Fold of pGL-2 control) ATTTCAATAGGCTCCCTGTTTCGGAGGAAAAAAGATAACAAACGTAAATC AluJ MaLR R I S I G S L F R K K D N K R K S 3) R E L N G G V D G I A S I E S I AAGGGAGCTAAATGGCGGGGTGGATGGAATTGCAAGTATTGAAAGTATAC AAGGGAGCTAAATGGCGGGGTGGATGGAATTGCAAGTATTGAAAGTATAC R E L N G G V D G I A S I E S I 115 bp 126 bp Primer AS2 RT-PCR Cloning & Sequencing Realtime RT-PCR Promoter assay Evolutionary Conservation of the Dorfin Gene Human 100 Dog Pig 77 100 Cattle 42 Mouse 100 Rat 100 Chicken Zebrafish - cloned from the anterior horn tissues Amyotrophic lateral sclerosis Parkinson’s disease 분류 연구 genome genome 수준에서의 연구는 이루어지지 않았음 transcriptome cDNA 서열결정 northern blot으로 발현패턴 확인 ALS에서의 전사체 발현양 연구 proteome E3 activity의 확인 dorfin이 존재하는 위치확인 신경퇴행성질병과의 관련성 연구 RBRfamily의 계통연구 parkin과의 homology연구 활성메카니즘에 관련된 연구(VCP관련) CaR의 degradation에 미치는 영향 연구 Other region SINE 13% 16% LINE NM_015435.3  20% HERV element 8% Gene-related Sequence DNA element Pseudogene 3% 1% 36% Coding sequence 3% Retroviral Element of RNF19 Gene : Structure, Expression, and Evolutionary Conservation Abstract Results & Discussion RNF19 gene located on human chromosome 8q22.2 has showed 4.4 kb transcript and expressed ubiquitously in various tissues. RNF19 gene coding dorfin protein that carry out E3 ubiquitin ligase, and highly conserved in pig, dog and cattle. RNF19 gene containing MaLR (mammalian LTR-retrotransposon) element in the first intron. Here we found its alternatively spliced transcript variants which derived from MaLR insertion. The MaLR-derived promoter transcripts are detected as two different types in all tissues examined, while breast tissue only showed three variant types. Reporter gene assay of the promoter activity of MaLR element on RNF19 gene indicated good activity in human colon carcinoma cells (HCT-116). These findings suggest that the MaLR element acquired the role of transcriptional regulation of RNF19 gene in various human tissues during primate evolution. . Expression of Dorfin gene by cellular promoter Introduction Skeletal muscle Adrenal gland Bone marrow Cerebellum Adult brain Spinal cord Fetal brain Fetal liver Placenta Trachea Prostate Thymus Thyroid Marker Marker Kidney Uterus Testis Heart Lung Liver Dorfin 494 bp 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Gapdh 195 bp Expression of Dorfin gene by MaLR-derived promoter Lung Relative Expression Testis Cerebellum Kidney Bone marrow Materials & Methods In silico analysis of transcription binding sites of MaLR element Promoter Activity of the MaLR Element 35cycle 94 ℃ : 40sec 56 ℃ : 30sec 72 ℃ : 40sec Modified PGL2-vector HCT116 Cos7 Lipofectamine Dual luciferase Assay 40cycle (Sybr green) 94 ℃ : 10sec 56 ℃ : 15sec 72 ℃ : 15sec References Qiaquick Gel-extraction Promega T-easy Vector EcoR-I(DH5α) Sin HS, Huh JW, Kim DS, Kang DW, Min DS, Kim TH, Ha HS, Kim HH, Lee SY, Kim HS. 2006. Transcriptional control of the HERV-H LTR element of the GSDML gene in human tissues and cancer cells. Arch. Virol. [Epub ahead of print] Hishikawa N, Niwa J, Doyu M, Ito T, Ishigaki S, Hashizume Y, Sobue G. 2003. Dorfin localizes to the ubiquitylated inclusions in Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, and amyotrophic lateral sclerosis. Am J Pathol. 163(2):609-619. Genome Information Lab

More Related