1 / 1

Analysis of Genetic Variants in Staphylococcus aureus Chromosome Sequences

This study presents an in-depth analysis of chromosome sequences from various strains of Staphylococcus aureus, including MSSA476, ZH4, ZH43, and others. We investigate specific genetic variations and mutations within the sequence segments, focusing on the conserved regions and their implications for pathogenicity and antibiotic resistance. The findings contribute to our understanding of Staphylococcus aureus's evolutionary adaptations and provide insight into potential targets for therapeutic interventions.

kylee
Télécharger la présentation

Analysis of Genetic Variants in Staphylococcus aureus Chromosome Sequences

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. chromosome-SCC SCC-chromosome cured strains agtgtatagagcatttaagattatgcgtgga gaggcgtatcataagtga N315 agtgtatagagcatttaagattatgcgtggaGAAGCATATCATAAATGATGCGGTTTTTC - - - TTAAAAAAACCTCATCATTAACTGATACGCAgaggcgtatcataagtaa MSSA476 agtgtacagagcatttaagattatgcgtggaGAAGCTTATCATAAATGATGCGGTTTTTT - - - GTATAAAAACCGCATCATTAACCGATACGCAgaggcgtatcataagtaa ZH4 agtgtatagagcatttaagattatgcctggaGAAGCATATCATAAATGATGCGGTTTTTA - - - GTATAAAAACCGCATCATTAACCGATACGCAgaggcgtatcataagtga ZH43 agtgtatagagcatttaagattatgcgtggaGAAGCATATCATAAATGATGCGGTTTTTA - - - GTATAAAAACCGCATCATTAACCGATACGCAgaggcgtatcataagtga ISS* GTATAAAAACCGCATCATTAACCGATACGCAgaggcgtatcataagtga ZH81 agtgtatagagcatttaagattatgcgtggaGAAGCATATCATAAATGATGCGGTTTTTA - - - TTTTATTAACCGCATCATAAACTGATAAGTAgaggcgtatcataagtga CHE482 agtgtatagagcatttaagattatgcgtggaGAAGCATATCATAAATGATGCGGTTTTTA - - - TTTTATTAACCGCATCATAAACTGATAAGTAgaggcgtatcataagtga attBSCC (**) AGTGTA—GAGC-TTTAAGATTATG-G-GGA GA-GC-TATCATAA-T-- ISS (**) GANGCNTATCANAANTNN

More Related