450 likes | 560 Vues
Jemboss – a Graphical User Interface for the EMBOSS suite of programs. Command line based. Options not obvious – must be remembered. EMBOSS. Jemboss. Point and Click interface. Portable interface – use with PCs, Mac OSX, UNIX. Options listed in program form. Databases. Remote server.
E N D
Jemboss – a Graphical User Interface for the EMBOSS suite of programs
Command line based Options not obvious – must be remembered EMBOSS Jemboss Point and Click interface Portable interface – use with PCs, Mac OSX, UNIX Options listed in program form
Databases Remote server EMBL accession =m93650 seqret -sequence em:m93650 -sbegin1 0 -send1 0 -nofirstonly -auto >HSPAX6AN M93650 Human paired box gene (PAX6) homologue, complete cds cagaggtcaggcttcgctaatgggccagtgaggagcggtggaggcgaggccggcgccgca cacacacattaacacacttgagccatcaccaatcagcataggaatctgagaattgctctc embl:m93650 Local computer
Tool bar EMBOSS applications Mode Job manager Local file manager
home directory preferred directory
programs are highlighted based unambiguous letters Selection from alphabetical list, using the “Go To” field
input possibilities calculates nature of sequence and default settings
Interactive mode – Jemboss is suspended until program has been completed
Saved file. All graphics files MUST be saved with a .png extension
Mode Job manager
job status job is processed in the background
Note: no command line tab Results can be saved in exactly the same manner as before.
input file and command line information is displayed select an application Notes on the experiment or analysis may be saved to the server along with the results
Disable parameters by shading (selected) or removing them (deselected) Auto-refresh. More often for slower connection, less often for a faster connection. Alteration of default home directory path setting
The server settings and environment information should be the same
Default output for Jemboss is fasta format, so this may have to be altered This third party software has also been incorporated into Jemboss
brief user guide The version should always be reported if there are any problems with the program