Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Jemboss – a Graphical User Interface for the EMBOSS suite of programs PowerPoint Presentation
Download Presentation
Jemboss – a Graphical User Interface for the EMBOSS suite of programs

Jemboss – a Graphical User Interface for the EMBOSS suite of programs

92 Views Download Presentation
Download Presentation

Jemboss – a Graphical User Interface for the EMBOSS suite of programs

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Jemboss – a Graphical User Interface for the EMBOSS suite of programs

  2. Command line based Options not obvious – must be remembered EMBOSS Jemboss Point and Click interface Portable interface – use with PCs, Mac OSX, UNIX Options listed in program form

  3. Databases Remote server EMBL accession =m93650 seqret -sequence em:m93650 -sbegin1 0 -send1 0 -nofirstonly -auto >HSPAX6AN M93650 Human paired box gene (PAX6) homologue, complete cds cagaggtcaggcttcgctaatgggccagtgaggagcggtggaggcgaggccggcgccgca cacacacattaacacacttgagccatcaccaatcagcataggaatctgagaattgctctc embl:m93650 Local computer

  4. Tool bar EMBOSS applications Mode Job manager Local file manager

  5. Local file manager

  6. home directory preferred directory

  7. confirm directory path

  8. new default directory

  9. EMBOSS applications

  10. Select appropriate program from the category menus

  11. programs are highlighted based unambiguous letters Selection from alphabetical list, using the “Go To” field

  12. input possibilities calculates nature of sequence and default settings

  13. Database entry in format database:entry

  14. drag and drop the file into the sequence field

  15. File (path) now specified

  16. cut and paste a sequence from elsewhere

  17. Mode

  18. Interactive mode – Jemboss is suspended until program has been completed

  19. results tab

  20. input files tab

  21. command line tab

  22. Saved file. All graphics files MUST be saved with a .png extension

  23. Mode Job manager

  24. job status job is processed in the background

  25. job status

  26. Note: no command line tab Results can be saved in exactly the same manner as before.

  27. Tool bar

  28. input file and command line information is displayed select an application Notes on the experiment or analysis may be saved to the server along with the results

  29. Disable parameters by shading (selected) or removing them (deselected) Auto-refresh. More often for slower connection, less often for a faster connection. Alteration of default home directory path setting

  30. The server settings and environment information should be the same

  31. Default output for Jemboss is fasta format, so this may have to be altered This third party software has also been incorporated into Jemboss

  32. This is the beginnings of a project management system.

  33. brief user guide The version should always be reported if there are any problems with the program