Protein Synthesis
This overview covers the essential processes of DNA replication and protein synthesis, detailing how cells accurately copy DNA through semi-conservative replication utilizing base-pairing rules. It explores transcription, where DNA is converted to mRNA, and translation, the process by which mRNA is decoded by ribosomes with the help of tRNA to synthesize proteins. Key concepts include the central dogma, the roles of codons and the genetic code, and the significance of post-transcriptional modifications to mRNA.
Protein Synthesis
E N D
Presentation Transcript
5b. Students know how to apply base-pairing rules to explain precise copying of DNA during semiconservative replication and transcription of information from DNA into mRNA. 4a Students know the general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA. 4b Students know how to apply the genetic code rules to predict the sequence of amino acids from a sequence of codons in RNA Protein Synthesis
Replication • DNA double helix unwinds • DNA now single-stranded • New DNA strand forms using complementary base pairing (A-T, C-G) • Used to prepare DNA for cell division • Whole genome copied/replicated
The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait DNA gets all the glory, but proteins do all the work! replication
a a a a a ribosome aa aa aa aa a aa Where? nucleus cytoplasm transcription translation DNA mRNA protein trait
Transcription and Translation: An Overview (aka the Central Dogma) Transcription Translation
Transcription • From DNA nucleic acid languageto RNA nucleic acid language
Transcription • RNA forms base pairs with DNA • C-G • A-U • Primary transcript- length of RNA that results from the process of transcription
Messenger RNA • mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus
Transcription • Making mRNA • transcribed DNA strand = template strand • untranscribed DNA strand = coding strand • same sequence as RNA • synthesis of complementary RNA strand • enzyme • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53
RNA polymerase • RNA polymerase- Produce primary transcript by stringing together the chain of RNA nucleotides
Which gene is read? • Promoter region • binding site before beginning of gene • TATA box binding site • binding site for RNA polymerase & transcription factors • Enhancer region • binding site far upstream of gene • turns transcription on HIGH
Transcription Factors • Initiation complex • transcription factors bind to promoter region • suite of proteins which bind to DNA • hormones? • turn on or off transcription • trigger the binding of RNA polymerase to DNA
RNA polymerase Matching bases of DNA & RNA A C U G • Match RNA bases to DNA bases on one of the DNA strands A G G U C U U G C A C A U A G A C U A 5' 3' G C C A T G G T A C A G C T A G T C A T C G T A C C G T
intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have untranscribed regions! • Eukaryotic genes are not continuous • exons = the real gene • expressed / coding DNA • introns = the junk • inbetween sequence intronscome out! eukaryotic DNA
intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • primary transcript = pre-mRNA • mRNA splicing • edit out introns • make mature mRNA transcript ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA
3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G More post-transcriptional processing • Need to protect mRNA on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • protect the ends of the molecule • add 5 GTP cap • add poly-A tail • longer tail, mRNA lasts longer: produces more protein
Transcription is done…what now? Now we have mature mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we “read” the code?
Translation • From nucleic acidlanguageto amino acidlanguage
Translation • Second stage of protein production • mRNA is on a ribosome
Reading the DNA code • Every 3 DNA bases pairs with 3 mRNA bases • Every group of 3 mRNA bases encodes a single amino acid • Codon- coding triplet of mRNA bases
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets
Translation • Second stage of protein production • mRNA is on a ribosome • tRNA brings amino acids to the ribosome
The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG
GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid
Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end
Ribosomes • Facilitate coupling of tRNAanticodon to mRNA codon • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A
Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • emptytRNAleaves ribosome from exit site Met C A U 5' G U A 3' E P A
3 2 1 Building a polypeptide • Initiation • mRNA, ribosome subunits, initiator tRNA come together • Elongation • adding amino acids based on codons • Termination • STOP codon = Release factor release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A
Protein targeting • Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… • Signal peptide • address label start of a secretory pathway
RNA polymerase DNA Can you tell the story? aminoacids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyltRNAsynthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome
enhancer translation start translation stop exons 1000+b 20-30b RNA polymerase DNA UTR UTR introns promoter transcription start transcription stop pre-mRNA 5' 3' 5' 3' mature mRNA Processing transcriptional unit (gene) 3' 5' TAC ACT TATA DNA GTP AAAAAAAA
Bacterial chromosome Transcription mRNA Protein Synthesis in Prokaryotes Psssst…no nucleus! Cell membrane Cell wall
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes eukaryotic DNA intronscome out!
Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed
Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • no RNA processing
Mutations • Point mutations • single base change • silent mutation • no amino acid change • redundancy in code • missense • change amino acid • nonsense • change to stop codon When do mutationsaffect the nextgeneration?
Point mutation lead to Sickle cell anemia What kind of mutation? Missense!
Mutations • Frameshift • shift in the reading frame • changes everything “downstream” • insertions • adding base(s) • deletions • losing base(s) Where would this mutation cause the most change:beginning or end of gene?
Transcription Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein Transcription vs. Translation Review