laken
Uploaded by
40 SLIDES
534 VUES
400LIKES

Protein Synthesis

DESCRIPTION

This overview covers the essential processes of DNA replication and protein synthesis, detailing how cells accurately copy DNA through semi-conservative replication utilizing base-pairing rules. It explores transcription, where DNA is converted to mRNA, and translation, the process by which mRNA is decoded by ribosomes with the help of tRNA to synthesize proteins. Key concepts include the central dogma, the roles of codons and the genetic code, and the significance of post-transcriptional modifications to mRNA.

1 / 40

Télécharger la présentation

Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. 5b. Students know how to apply base-pairing rules to explain precise copying of DNA during semiconservative replication and transcription of information from DNA into mRNA. 4a Students know the general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA. 4b Students know how to apply the genetic code rules to predict the sequence of amino acids from a sequence of codons in RNA Protein Synthesis

  2. Replication • DNA double helix unwinds • DNA now single-stranded • New DNA strand forms using complementary base pairing (A-T, C-G) • Used to prepare DNA for cell division • Whole genome copied/replicated

  3. The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait DNA gets all the glory, but proteins do all the work! replication

  4. a a a a a ribosome aa aa aa aa a aa Where? nucleus cytoplasm transcription translation DNA mRNA protein trait

  5. Transcription and Translation: An Overview (aka the Central Dogma) Transcription Translation

  6. Transcription • From DNA nucleic acid languageto RNA nucleic acid language

  7. Transcription • RNA forms base pairs with DNA • C-G • A-U • Primary transcript- length of RNA that results from the process of transcription

  8. Messenger RNA • mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus

  9. Transcription • Making mRNA • transcribed DNA strand = template strand • untranscribed DNA strand = coding strand • same sequence as RNA • synthesis of complementary RNA strand • enzyme • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

  10. RNA polymerase • RNA polymerase- Produce primary transcript by stringing together the chain of RNA nucleotides

  11. Which gene is read? • Promoter region • binding site before beginning of gene • TATA box binding site • binding site for RNA polymerase & transcription factors • Enhancer region • binding site far upstream of gene • turns transcription on HIGH

  12. Transcription Factors • Initiation complex • transcription factors bind to promoter region • suite of proteins which bind to DNA • hormones? • turn on or off transcription • trigger the binding of RNA polymerase to DNA

  13. RNA polymerase Matching bases of DNA & RNA A C U G • Match RNA bases to DNA bases on one of the DNA strands A G G U C U U G C A C A U A G A C U A 5' 3' G C C A T G G T A C A G C T A G T C A T C G T A C C G T

  14. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have untranscribed regions! • Eukaryotic genes are not continuous • exons = the real gene • expressed / coding DNA • introns = the junk • inbetween sequence intronscome out! eukaryotic DNA

  15. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • primary transcript = pre-mRNA • mRNA splicing • edit out introns • make mature mRNA transcript ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

  16. 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G More post-transcriptional processing • Need to protect mRNA on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • protect the ends of the molecule • add 5 GTP cap • add poly-A tail • longer tail, mRNA lasts longer: produces more protein

  17. Transcription is done…what now? Now we have mature mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we “read” the code?

  18. Translation • From nucleic acidlanguageto amino acidlanguage

  19. Translation • Second stage of protein production • mRNA is on a ribosome

  20. Reading the DNA code • Every 3 DNA bases pairs with 3 mRNA bases • Every group of 3 mRNA bases encodes a single amino acid • Codon- coding triplet of mRNA bases

  21. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets

  22. Translation • Second stage of protein production • mRNA is on a ribosome • tRNA brings amino acids to the ribosome

  23. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  24. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid

  25. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

  26. Ribosomes • Facilitate coupling of tRNAanticodon to mRNA codon • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

  27. Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • emptytRNAleaves ribosome from exit site Met C A U 5' G U A 3' E P A

  28. 3 2 1 Building a polypeptide • Initiation • mRNA, ribosome subunits, initiator tRNA come together • Elongation • adding amino acids based on codons • Termination • STOP codon = Release factor release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

  29. Protein targeting • Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… • Signal peptide • address label start of a secretory pathway

  30. RNA polymerase DNA Can you tell the story? aminoacids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyltRNAsynthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

  31. enhancer translation start translation stop exons 1000+b 20-30b RNA polymerase DNA UTR UTR introns promoter transcription start transcription stop pre-mRNA 5' 3' 5' 3' mature mRNA Processing transcriptional unit (gene) 3' 5' TAC ACT TATA DNA GTP AAAAAAAA

  32. Bacterial chromosome Transcription mRNA Protein Synthesis in Prokaryotes Psssst…no nucleus! Cell membrane Cell wall

  33. Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes eukaryotic DNA intronscome out!

  34. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

  35. Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • no RNA processing

  36. Mutations • Point mutations • single base change • silent mutation • no amino acid change • redundancy in code • missense • change amino acid • nonsense • change to stop codon When do mutationsaffect the nextgeneration?

  37. Point mutation lead to Sickle cell anemia What kind of mutation? Missense!

  38. Mutations • Frameshift • shift in the reading frame • changes everything “downstream” • insertions • adding base(s) • deletions • losing base(s) Where would this mutation cause the most change:beginning or end of gene?

  39. Transcription Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein Transcription vs. Translation Review

More Related