200 likes | 827 Vues
pMAL Protein Fusion and Purification System. Overview. MBP-paramyosin Sal. purified. separated. cleaved. uninduced. stop. induced. pMAL-c5X. P tac . Kit also includes pMAL-p5X – fusion protein exported to the periplasmic space. MCS. T2. T1. pMAL-5 MCS. XmnI. NdeI. NcoI.
E N D
Overview MBP-paramyosinSal purified separated cleaved uninduced stop induced
pMAL-c5X P tac Kit also includespMAL-p5X – fusion protein exported to the periplasmic space MCS T2 T1
pMAL-5 MCS XmnI NdeI NcoI NotI EcoRV SalI BamHI EcoRI SbrfI ATCGAGGGAAGGATTTCACATATGTCCATGGGCGGCCGCGATATCGTCGACGGATCCGAATTCCCTGCAGGTAATTAAATAA I E G R GATGACGATGACAAGGTACCGCATATG ... D D D D K CCGGGTGCGGCACACTACGTACATATG ... P G A A H Y NdeI KpnI SnaBI NdeI • -core MCSidenticle in K. lactispKLAC2 and Impact pTYB21 vectors • NdeI and NcoI facilitate cloning from unfused clones in pET vectors, etc. • contains 1 blunt and 2 eight-base sites • stop codons in all three frames
Kit Components • pMAL-c5X, pMAL-p5X • Amylose resin • Factor Xa • MBP5 • MBP5-paramyosin∆Sal • Anti-MBP serum • NEB Express host cells • Manual
14 kDa 16 kDa 19 kDa 25 kDa 27 kDa 29 kDa MBP is good for solubility Shih et al., 2002, Protein Science 11:1714-19 32 yeast, mammalian, plant and insect genes Kapust & Waugh,1999, Protein Science 8:1668-74
Expression and purification ofPNGaseF A B C D Expressed in pMAL-p2 Only active when expressed periplasmically MBP-PNGase F
Cleavage of MBP-D. immitis antigen 5 Genenase I Factor Xa U 2 4 6 24 U M 2 4 6 24 MBP-Di5 MBP Di5
pMAL companion products Antibodies Anti-MBP Antiserum Anti-MBP Monoclonal Antibody Anti-MBP Monoclonal Antibody (HRP conjugated) Anti-MBP Magnetic Beads Vectors pMAL-c5E Vector pMAL-c5G Vector pMAL-c5X Vector pMAL-p5E Vector pMAL-p5G Vector pMAL-p5X Vector pMAL-pIII Vector Binding matrices Amylose Resin Amylose Resin High Flow Amylose Magnetic Beads Proteins MBP5 Protein MBP5-paramyosin-ΔSal Specific proteases Enterokinase, light chain Factor Xa Protease Genenase I
Other systems NameTagSpecific proteaseCompany pQE-1,2 poly-histidineTAGzyme Qiagen pQE-30 poly-histidine FXa Qiagen pQE-Trisystem poly-histidine, Streptag II Qiagen pGEX glutathione-S-transferase (GST) thrombin, factor Xa, 3c protease GE Life Sciences pET-HIS poly-histidine thrombin, FXa, enterokinase EMD pET-STag modified RNase thrombin, FXa, enterokinase EMD pET CBD cellulose-binding thrombin, FXa, enterokinase EMD pET Dsb S-Tag and poly-his thrombin, FXa, enterokinase EMD pDEST vectors GST, poly-histidine TEV protease, enterokinase Invitrogen pET-SUMO poly-histidine SUMO protease Invitrogen pRSET, pTrcHispoly-histidineenterokinase Invitrogen plus others Halo tag poly-histidine TEV protease Promega PinPointbiotinylated E. coli protein factor Xa Promega Flag tag peptide epitope/monoclonal enterokinase Sigma