lenore-holder
Uploaded by
15 SLIDES
321 VUES
150LIKES

Protein Synthesis

DESCRIPTION

Protein Synthesis. Beth Walker. Importance of Proteins & DNA. DNA carries the instructions for making all proteins. A portion of a DNA strand with instructions for making a protein is called a gene Proteins are made up of many building blocks or monomers called amino acids.

1 / 15

Télécharger la présentation

Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Protein Synthesis Beth Walker

  2. Importance of Proteins & DNA • DNA carries the instructions for making all proteins. • A portion of a DNA strand with instructions for making a protein is called a gene • Proteins are made up of many building blocks or monomers called amino acids.

  3. Importance of Proteins & DNA • Proteins perform the following important functions: • Enzymes, which speed up chemical reaction sin the body. • Keratin, which makes up our hair and nails. • Collagen, which makes up our skin. • Hemoglobin, which transports O2 in our body E. There are 20 different amino acids, such as valine, lysine, and leucine, which are put in various arrangements to make proteins

  4. Transcription: making mRNA from DNA

  5. How Does Transcription Occur? • Starts with replication • Location: nucleus and cytoplasm • DNA is once again split apart by an enzyme • Free-floating mRNA nucleotides attach to the exposed DNA strand. REMEMBER THERE IS NO THYMINE IN mRNA!!!!!

  6. Transcription

  7. How Does Transcription Occur? • mRNA separates from DNA and we now have a single-strand of messenger RNA. 6. Three nucleotides on an mRNA strand are called a codon. By looking at a codon chart, we can determine the amino acid that mRNA strand will put together.

  8. Codon Chart

  9. Using the Chart • PRACTICE USING THE CODON CHART……look up the amino acid for each codon listed below. UUG  leucine UAC  tyrosine ACG  theorine AAA  lysine

  10. Using the Codon Chart • ***Notice that there are start and stop codons that will tell where to begin and where to end the protein. • The start codon is AUG, so the first amino acid in a protein will always be methionine 8. The stop codons are UAA, UGA, and UAG. The last amino acid in a protein will always be coded by a “stop” codon.

  11. How Does Translation Occur?

  12. How does Translation Occur? • The amino acids coded for by the codons are linked together to make a protein. • Location: ribosome • mRNA travels out of the nucleus to a ribosome. 4. The ribosome looks for the “start” codon.

  13. Translation

  14. How Does Translation Occur? • All codons after that will attach to the ribosome. 6. In the cytoplasm, tRNA, a clover-leaf shaped RNA, will attach to free floating amino acids and form anticodons (made up of tRNA). 7. Amino acids come from proteins that we eat and they are broken down during digestion. 8. tRNA pairs with mRNA and brings the correct amino acid with it to the ribosome. • Peptide bonds are formed between the amino acids, and voila, a protein is formed. Transcribe & Translate a Gene Here

  15. Transcription & Translation – Practice Problem DNA: GCGTATTACGGGGTGCCATATACTGGT mRNA: tRNA: Protien:

More Related