DNA Mismatch Repair Deficient Colorectal Cancer an emerging distinct subtype

1. DNA Mismatch Repair Deficient Colorectal Cancer – an emerging distinct subtype Gayathri Nagaraj Grand rounds, 3/26/2010

2. Overview The DNA mismatch repair (MMR) system Deficient mismatch repair (dMMR) in colorectal cancer Microsatellite instability (MSI) Lynch syndrome The dMMR phenotype Identification of dMMR Clinical implications Management & surveillance in Lynch syndrome dMMR as a prognostic marker dMMR as a marker of response to chemotherapy Novel therapeutic targets in dMMR CRC Future directions/conclusions

3. Introduction 15% - 17% of colorectal cancers display a deficient MMR repair system as a result of either inherited or sporadic abnormalities. They are associated with distinct clinicopathological characteristics. Methods to detect them are well established and routinely incorporated into clinical practice. Studies have confirmed that dMMR CRC are associated with a better prognosis. Stage 2 CRC with a dMMR might not benefit from 5-fluorouracil based adjuvant chemotherapy. Characterization of the molecular basis of dMMR in CRC is underway and initial results show multiple pathways that could be exploited as novel therapeutic targets ProloguePrologue

4. DNA mismatch repair system The most common error during DNA replication is a simple mispairing of nucleotides (predicted to occur once every 103-104 basepairs). If left unrepaired, these errors may result in permanent mutations. The second type of error is a “slippage” of the DNA polymerase complex. This slippage occurs during the replication of microsatellite DNA sequences. Microsatellites are defined as short dinucleotide (5’…..TCAATGCCACACACACACACATGAGGC…) or mononucleotide (5’……TCTAGGCTAAAAAAAAATGCCGAGTAC…) repeats. Slippage causes the daughter strands to have either too few or too many copies of these repeated sequences.

5. DNA mismatch repair system DNA mismatch repair is a system of proofreading. It not only corrects the single base-pair mismatches but also small mispaired loops of DNA that result from replication errors of microsatellite tracts. With an intact mismatch repair mechanisms the errors of slippage are quickly corrected and microsatellite DNA sequences are considered stable. If these errors are not corrected the phenomenon is called MSI. The DNA mismatch repair system requires the cooperation of many genes from the mutS and mutL families. Instrumental to this process are the products of these genes which form two protein dimer complexes hMutS and hMutL. mutS –hMSH2, hMSH3, hMSH6 - recognition mutL- hMLH1, hMLH3, hPMS1 and hPMS2 - excision

6. Mismatch repair proteins http://www.rug.nl/umcg/faculteit/disciplinegroepen/medischegenetica/research/lynchsyndrome/index http://www.rug.nl/umcg/faculteit/disciplinegroepen/medischegenetica/research/lynchsyndrome/index

7. Schematic representation of mismatches and the MMR pathway. The MMR system recognizes a | a base– base mismatch or b | an insertion–deletion loop. c | MutS homologs bind to the affected site of DNA, which triggers ATP-dependent conformational changes and the binding of MutL homologs. These in turn recruit other proteins, including PCNA and exonucleases with the subsequent excision of the damaged strand. The interactions of the bound proteins trigger DNA looping, which brings the two sites together. The resultant gap in the strand is then filled by DNA polymerases and the break is removed by DNA ligase.2,127 Abbreviations: eXO1, exonuclease 1; PCNA, proliferating-cell-nuclear-antigen.Schematic representation of mismatches and the MMR pathway. The MMR system recognizes a | a base– base mismatch or b | an insertion–deletion loop. c | MutS homologs bind to the affected site of DNA, which triggers ATP-dependent conformational changes and the binding of MutL homologs. These in turn recruit other proteins, including PCNA and exonucleases with the subsequent excision of the damaged strand. The interactions of the bound proteins trigger DNA looping, which brings the two sites together. The resultant gap in the strand is then filled by DNA polymerases and the break is removed by DNA ligase.2,127 Abbreviations: eXO1, exonuclease 1; PCNA, proliferating-cell-nuclear-antigen.

8. Microsatellite instability The DNA polymerase enzyme adds complementary deoxynucleotide bases to the growing strand. Slippage may occur when microsatellite DNA sequences are encountered. In this example, there are six copies of a CA dinucleotide repeat. Because of slippage, an additional CA repeat is inserted, resulting in a mismatched loop of DNA. With an intact DNA mismatch repair system, the error is corrected and DNA microsatellite stability (MSS) is observed. However, when the DNA mismatch repair system is mutated, the error is not corrected and microsatellite instability (MSI) results.The DNA polymerase enzyme adds complementary deoxynucleotide bases to the growing strand. Slippage may occur when microsatellite DNA sequences are encountered. In this example, there are six copies of a CA dinucleotide repeat. Because of slippage, an additional CA repeat is inserted, resulting in a mismatched loop of DNA. With an intact DNA mismatch repair system, the error is corrected and DNA microsatellite stability (MSS) is observed. However, when the DNA mismatch repair system is mutated, the error is not corrected and microsatellite instability (MSI) results.

9. Pathogenesis of deficient DNA MMR system The deficient MMR system can arise from A mutation in one of the several mismatch repair genes results in dMMR activity – germline or somatic DNA. Epigenetic suppression of MMR gene expression Combination of these factors. MMR genes generally function as classical tumor suppressor genes, where loss of function of both alleles is required. Germline mutations are responsible for a genetic predisposition to CRC known as Lynch syndrome (3% CRC). Sporadic dMMR constitutes the majority of dMMR CRC (15%) and the cause is frequently suppression of MLH1 transcription owing to biallelic hypermethylation of the MLH1 promoter.

10. Genetic Instability Pathways That Drive Colon Neoplasias

11. Mechanisms of dMMR The direct consequence of defective DNA MMR is “mutator or replication-error phenotyte”. dMMR instead of causing malignant transformation directly creates a milieu that permits mutations to accumulate in other growth-regulatory genes. Most microsatellite sequences in the genome are located within noncoding or intrionic sequences and mutations in these introns are believed to be silent or inconsequential. Some genes may contain microsatellites within their coding regions and hence can be affected. More than 30 genes have mutations arising in microsatellite repeats in dMMR tumors have been identified affecting diverse cellular functions.

12. MUTATOR PHENOTYPE Examples: DNA repair proteins-MRE11A and hRAD50, growth factors TGF-ß receptor II, IGF receptor II, pro-apoptotic factor BAX, histone modifier HDAC2, other mismatch repair genes MSH3 and MSH6. There are probably yet unidentified additional MSI-independent mechanisms through which dMMR results in tumor formation. Examples: DNA repair proteins-MRE11A and hRAD50, growth factors TGF-ß receptor II, IGF receptor II, pro-apoptotic factor BAX, histone modifier HDAC2, other mismatch repair genes MSH3 and MSH6. There are probably yet unidentified additional MSI-independent mechanisms through which dMMR results in tumor formation.

13. Tumor progression model in dMMR dMMR phenotype has been strongly associated with mutations in specific oncogenes and tumor suppressor genes, especially BRAF , MRE11A and KRAS. BRAF V600E mutations are present in 10% of CRC and have a strong association with sporadic dMMR tumors as compared to lynch syndrome. Majority of CRC is characterized by genetic instability that arises from loss or gain of chromosomes, translocations or gene amplications, also referred to as chromosomal instable tumors (CIN). One of the classic models for CIN is the multistep model of adenoma progression to carcinoma proposed by Fearon and Vogelstein. By contrast dMMR CRC/MSI tumors shows stable karyotype . Although mutations in these pathways are not unique to dMMR tumors. The importance of the resultant events could lead to ways o exploiting these specific genes and pathways as potential drug targets and markers of sensitivity to therapies.Although mutations in these pathways are not unique to dMMR tumors. The importance of the resultant events could lead to ways o exploiting these specific genes and pathways as potential drug targets and markers of sensitivity to therapies.

14. CRC progression models and therapeutic targets in CIN and dMMR phenotypes CRC progression models and therapeutic targets in MSI and MSS CRC. Molecular CRC groups based on a | chromosomal instability and b | the mutator phenotype. The genetic models for CRC tumorigenesis are presented in parallel for each pathway of tumor development. Targeted therapies based on molecular events are also presented for MSI tumors. Abbreviations: CRC, colorectal cancer; MSI, microsatellite instability; MSS, microsatellite stable. Genetic defect in MSI-H CRC MLH1 hypermethylation BRAF V600E mutation and other types PIK3CA mutation/PTEN mutation or promoter hypermethylation MRE11A and hRAD50 mutation Therapeutic intervention HDAC inhibitors BRAF inhibitor mTOR and dual PI3K-mTOR inhibitor PARP inhibitors Fearon and Vogelstein- outlines the contribution of somatic mutation events to the pathogenesis of CRC. By contrast MSI crc shows stable karyotype . CRC progression models and therapeutic targets in MSI and MSS CRC. Molecular CRC groups based on a | chromosomal instability and b | the mutator phenotype. The genetic models for CRC tumorigenesis are presented in parallel for each pathway of tumor development. Targeted therapies based on molecular events are also presented for MSI tumors. Abbreviations: CRC, colorectal cancer; MSI, microsatellite instability; MSS, microsatellite stable. Genetic defect in MSI-H CRC MLH1 hypermethylation BRAF V600E mutation and other types PIK3CA mutation/PTEN mutation or promoter hypermethylation MRE11A and hRAD50 mutation Therapeutic intervention HDAC inhibitors BRAF inhibitor mTOR and dual PI3K-mTOR inhibitor PARP inhibitors Fearon and Vogelstein- outlines the contribution of somatic mutation events to the pathogenesis of CRC. By contrast MSI crc shows stable karyotype .

15. Lynch syndrome Also called hereditary nonpolyposis colorectal cancer, is the most common of the inherited colon cancer susceptibility syndromes. Lynch syndrome is an autosomal dominant disorder that is caused by a germline loss-of-function mutation in one of several DNA mismatch repair genes. The second hit happens somatically: mutations, gene conversions, promoter hypermethylation It accounts for 2-3% of all colon cancers. Early onset and multiplicity of cancers have been considered hallmarks of Lynch syndrome. The adenoma-carcinoma sequence is accelerated. Associated with markedly increased risk of endometrial cancer (2%) and other cancers including ovarian, upper urologic tract, gastric, small bowel, biliary/pancreatic, skin and brain cancers. The causative germline abnormality is usually a non-sense or frameshift mutation resulting in truncated non-functional protein. The overall 5 year survival rate is better than sporadic CRCThe causative germline abnormality is usually a non-sense or frameshift mutation resulting in truncated non-functional protein. The overall 5 year survival rate is better than sporadic CRC

16. Identification of individuals with lynch syndrome

17. Histological features of colorectal cancers with deficient MMR Histologic features of colorectal cancers with deficient mismatch repair: Characteristic tumor types include mucinous (A), signet-ring cell (B), and medullary (C, D). The medullary tumor at left is composed of sheets of monomorphic cells without appreciable glandular differentiation; the example at right demonstrates trabecular architecture and is associated with a prominent lymphoid infiltrate. Typical histologic features include frequent tumor infiltrating lymphocytes (E), a ‘‘pushing border’’ and Crohn’s-like reaction (F), and tumor heterogeneity (G). The tumor in ‘‘G’’ combines mucinous (left) and cribriform (right) patterns (H&E, A-E original magnification 400, F 40, and G 200).Histologic features of colorectal cancers with deficient mismatch repair: Characteristic tumor types include mucinous (A), signet-ring cell (B), and medullary (C, D). The medullary tumor at left is composed of sheets of monomorphic cells without appreciable glandular differentiation; the example at right demonstrates trabecular architecture and is associated with a prominent lymphoid infiltrate. Typical histologic features include frequent tumor infiltrating lymphocytes (E), a ‘‘pushing border’’ and Crohn’s-like reaction (F), and tumor heterogeneity (G). The tumor in ‘‘G’’ combines mucinous (left) and cribriform (right) patterns (H&E, A-E original magnification 400, F 40, and G 200).

18. Identification of dMMR Mutations in MMR genes can be identified by DNA sequencing. Immunohistochemistry (IHC) on tumor samples detects the presence or absence of MMR protein. Popular alternative to MSI and a complement to genetic testing. The IHC pattern takes advantage of the dependent expression of specific heterodimers. Use of Antibodies against MLH1, MSH2, MSH6 and PMS2 provides insight into functionality of the MMR system. Lack of expression of one or more of these proteins is diagnostic of dMMR IHC also helps determine which encoding gene is affected and helps focus on further genetic workup.

19. IHC patterns *Lack of MSH2 and MSH6 expression is usually due to a germline mutation in MSH2, although it can also be caused by transcriptional read-through of the neighboring EPCAM gene, which inactivates MSH2. ‡MLH1 can be inactivated by germline mutation or hypermethylation of the MLH1 promoter. Methylation of the MLH1 promoter is typically accompanied by BRAF V600E somatic mutations. Abbreviations: +, present; –, absent; MMR, mismatch repair; MSI, microsatellite instability; MSS, microsatellite stable.*Lack of MSH2 and MSH6 expression is usually due to a germline mutation in MSH2, although it can also be caused by transcriptional read-through of the neighboring EPCAM gene, which inactivates MSH2. ‡MLH1 can be inactivated by germline mutation or hypermethylation of the MLH1 promoter. Methylation of the MLH1 promoter is typically accompanied by BRAF V600E somatic mutations. Abbreviations: +, present; –, absent; MMR, mismatch repair; MSI, microsatellite instability; MSS, microsatellite stable.

20. Immunohistochemical Staining for Mismatch-Repair Proteins in CRC

21. Microsatellite instability detection The MSI status of the mutator phenotype can be detected by PCR amplification. In dMMR, the length of the microsatellites are altered and can be easily measured in extracted tumor tissue. The length of nucleotide repeats is compared against normal DNA extracted from adjacent normal mucosa. This analysis is internationally standardized with use of a reference panel known as Bethesda panel of 5 standard microsatellite markers (some labs use upto 10 reference panels) MSI –high (MSI-H) –instability in 2 or more loci or >30% of loci MSI – low (MSI-L) – instability at 1 locus or10-30% of loci MSS (stable) – no loci or <10% with instability.

22. Colorectal Cancers with High-Frequency Microsatellite Instability (MSI) and Microsatellite Stability (MSS). Colorectal Cancers with High-Frequency Microsatellite Instability (MSI) and Microsatellite Stability (MSS). The MSI colorectal cancer displays shifted bands in tumor DNA (T) as compared with normal DNA (N) at the BAT-25, BAT-26, D2S123, D5S346, and D17S250 microsatellite loci. The MSS colorectal cancer has identical bands in tumor and normal DNA at the BAT-25, BAT-26, D2S123, and D5S346 microsatellite loci. In addition, the MSS colorectal cancer displays loss of heterozygosity at the D17S250 locus — that is, a loss of the top (larger) allele in tumor DNA as compared with normal DNA.Colorectal Cancers with High-Frequency Microsatellite Instability (MSI) and Microsatellite Stability (MSS). The MSI colorectal cancer displays shifted bands in tumor DNA (T) as compared with normal DNA (N) at the BAT-25, BAT-26, D2S123, D5S346, and D17S250 microsatellite loci. The MSS colorectal cancer has identical bands in tumor and normal DNA at the BAT-25, BAT-26, D2S123, and D5S346 microsatellite loci. In addition, the MSS colorectal cancer displays loss of heterozygosity at the D17S250 locus — that is, a loss of the top (larger) allele in tumor DNA as compared with normal DNA.

23. Comparison of IHC and MSI for testing dMMR *We do not believe mismatch repair IHC represents genetic testing, but this has been argued by a small number of individuals. IHC indicates immunohistochemistry; MSI, microsatellite instability; MSI-H, high-level MSI; MSI-L, low-level MSI.*We do not believe mismatch repair IHC represents genetic testing, but this has been argued by a small number of individuals. IHC indicates immunohistochemistry; MSI, microsatellite instability; MSI-H, high-level MSI; MSI-L, low-level MSI.

24. Clinicopathologic comparison of lynch syndrome versus sporadic MSI-H *Each of these features was shown to occur significantly less frequently in ‘‘HNPCC-associated’’ versus sporadic MSI-H colorectal cancer in a study by Young et al.82 F indicates female; IHC, immunohistochemistry; M, male; MSI, microsatellite instability; MSI-H, high-level MSI.*Each of these features was shown to occur significantly less frequently in ‘‘HNPCC-associated’’ versus sporadic MSI-H colorectal cancer in a study by Young et al.82 F indicates female; IHC, immunohistochemistry; M, male; MSI, microsatellite instability; MSI-H, high-level MSI.

25. Clinical implications dMMR/MSI as a prognostic marker dMMR/MSI as marker of response to chemotherapy 5-Fluorouracil based chemotherapy Irinotecan based chemotherapy Newer therapeutic targets and future directions dMMR and Msi are used interchageabledMMR and Msi are used interchageable

26. Aim: To derive a more precise estimate of the prognostic significance of MSI status. Methods: Studies stratifying survival in CRC patients by MSI were eligible for analysis. The principal outcome measure was hazard ratio (HR). Thirty two eligible studies, total of 7,642 cases including 1,277 with MSI. In nearly all of the studies, genotyping for MSI was performed retrospectively. The combined HR estimate for overall survival associated with MSI was 0.65. This benefit was maintained restricting analyses to clinical trial patients and patients with locally advanced CRC (HR=0.67). While data are limited, tumors with MSI derived no benefit from adjuvant 5-FU (HR=1.24). The precise explanation for how MSI status affords a better prognosis is not obvious. Allele loss at or mutation of DCC, TP53 and KRAS are all associated with a poorer prognosis and they are not common in MSI. Lymphocyte infiltration is commonly seen in tumors with MSI which may reflect the presence of immunogenic proteins. Although the value of adjuvant 5fu in st 3 crc is well established, its role in st2 is less clear with confliting evidence. Our findings indicate that MSI status has the potential to identify patients that should be treated by surgery alone, particularly patients with otherwise good prognosis disease. Msi was assessed by genotyping, solely by IHC alone was excluded. The primary outcome of interest was os and PFS. In patients treated with adjuvant 5-FU, CRCs with MSI had a better prognosis (HR=0.72). The precise explanation for how MSI status affords a better prognosis is not obvious. Allele loss at or mutation of DCC, TP53 and KRAS are all associated with a poorer prognosis and they are not common in MSI. Lymphocyte infiltration is commonly seen in tumors with MSI which may reflect the presence of immunogenic proteins. Although the value of adjuvant 5fu in st 3 crc is well established, its role in st2 is less clear with confliting evidence. Our findings indicate that MSI status has the potential to identify patients that should be treated by surgery alone, particularly patients with otherwise good prognosis disease. Msi was assessed by genotyping, solely by IHC alone was excluded. The primary outcome of interest was os and PFS. In patients treated with adjuvant 5-FU, CRCs with MSI had a better prognosis (HR=0.72).

27. Microsatellite Instability and CRC Prognosis

28. dMMR as a marker of response to chemotherapy Note that the majority of these trials are observational studies and some of them have retrospectively reviewed tumors collected in the context of randomized, controlled trials. Abbreviations: CT, chemotherapy; DFS, disease-free survival; FO, folinic acid; 5-FU, 5-fluorouracil; LEV, levamisol; MA, meta-analysis; mDFS, median disease-free survival; mOS, median overall survival; MSI-H, microsatellite instability-high; MTX, methotrexate; NR, non-randomized; OS, overall survival; P, prospective; R, retrospective; RCT, randomized controlled trial. Note that the majority of these trials are observational studies and some of them have retrospectively reviewed tumors collected in the context of randomized, controlled trials. Abbreviations: CT, chemotherapy; DFS, disease-free survival; FO, folinic acid; 5-FU, 5-fluorouracil; LEV, levamisol; MA, meta-analysis; mDFS, median disease-free survival; mOS, median overall survival; MSI-H, microsatellite instability-high; MTX, methotrexate; NR, non-randomized; OS, overall survival; P, prospective; R, retrospective; RCT, randomized controlled trial.

29. Background: MSI status in predicting the efficacy of adjuvant chemotherapy in CRC was assessed. Meta-analysis was performed for treated and untreated MSI population on seven studies representing 3690 patients, mean age 65.5 yrs, 810 patients with Stage 2 and 2444 patients with stage 3. MSI-H was found in 454 patients and MSS in 2,871. A total of 1444 patients received 5-FU based chemotherapy and 1,518 patients did not. For MSI-H patients, there was no statistically significant difference for RFS whether or not they received chemotherapy (HR RFS=0.96) and the HR OS = 0.70. This study found similar RFS for treated and untreated MSI-H patients, showing that MSI-H, in addition to being a good prognostic factor is also a predictive factor of non response. I chose only the meta-analysis because individual studies had a lot of controversies. The prior metaanalysis concluded a lack of benefit of adjuvant chemotherapy among MSI-H patieint but included only two articles where adjuvant treatment was compared with no treatment. The main purpose was to assess the predictive value of MSI –h status among poatient receiving or not receivingadjuvant chemotherapy for CRC. The prognosic value has been established, the predictive value is still a matter of debate. No prospective study randomised shemothearpy according to MSI status and compared its efficacy among MSI-H and MSS patients I chose only the meta-analysis because individual studies had a lot of controversies. The prior metaanalysis concluded a lack of benefit of adjuvant chemotherapy among MSI-H patieint but included only two articles where adjuvant treatment was compared with no treatment. The main purpose was to assess the predictive value of MSI –h status among poatient receiving or not receivingadjuvant chemotherapy for CRC. The prognosic value has been established, the predictive value is still a matter of debate. No prospective study randomised shemothearpy according to MSI status and compared its efficacy among MSI-H and MSS patients

30. Study characteristics Seven studies that qualified – assessed two cohorts, one receiving and the other not receiving an adjuvant chemotherapy. 2 of these studies included samples from RCT’s evaluating the potential benefit of adjuvant chemotherapy. Most of them received 5-FU based chemotherapy. A subgroup analyses consisting of stage 2 and 3 seperately could not be performed secondary to insufficient data. However the worse prognosis in stage 3 disease – mandates the use of adjuvant chemo.Seven studies that qualified – assessed two cohorts, one receiving and the other not receiving an adjuvant chemotherapy. 2 of these studies included samples from RCT’s evaluating the potential benefit of adjuvant chemotherapy. Most of them received 5-FU based chemotherapy. A subgroup analyses consisting of stage 2 and 3 seperately could not be performed secondary to insufficient data. However the worse prognosis in stage 3 disease – mandates the use of adjuvant chemo.

31. A similar MA in metastatic setting – showed that Msi status does not predict the effect of chemotherapy which is simiar in MSI-H and MSS patients.A similar MA in metastatic setting – showed that Msi status does not predict the effect of chemotherapy which is simiar in MSI-H and MSS patients.

32. Studies using Irinotecan Irinotecan is a topoisomerase 1 enzyme inhibitor, which generates a transient nick in dna strands during replication and transcription which allows the dna to relax. Irinotecan binds to DNA topoisomerase and traps it – preventing religation and te relication and transcription machinery collides causing double starnd breaks.. To repair the double starn breaks – 2 different mechanism – HR and NHR. For HR – dna repair proteins – MRE11a and hRAd50 complex – which can be defient in dMMR model of CRC. Data still emerging with regards to irinotecan 1st – retrospective study Calgb – predictive analysis showed a trend towards a higher benefit of MSI-H tumors Tejpar – did not confirm this observationIrinotecan is a topoisomerase 1 enzyme inhibitor, which generates a transient nick in dna strands during replication and transcription which allows the dna to relax. Irinotecan binds to DNA topoisomerase and traps it – preventing religation and te relication and transcription machinery collides causing double starnd breaks.. To repair the double starn breaks – 2 different mechanism – HR and NHR. For HR – dna repair proteins – MRE11a and hRAd50 complex – which can be defient in dMMR model of CRC. Data still emerging with regards to irinotecan 1st – retrospective study Calgb – predictive analysis showed a trend towards a higher benefit of MSI-H tumors Tejpar – did not confirm this observation

33. Newer Therapeutic Targets based on preclinical data Novel strategies include exploiting the sensitivity of dMMR tumor cells to standard chemotherapies, synthetic lethal strategies targeting the primary tumor, and targeting secondary mutations.86,104,105,115,116,119,131 Abbreviations: dMMR, deficient mismatch repair; HDAC, histone deacetylase; mTOR, mammalian target of rapamycin; PARP, poly-(ADP-ribose) polymerase; PI3K, phosphatidylinositol 3-kinase. Some of these are being planned to be tested in clinical trials for their validity.Novel strategies include exploiting the sensitivity of dMMR tumor cells to standard chemotherapies, synthetic lethal strategies targeting the primary tumor, and targeting secondary mutations.86,104,105,115,116,119,131 Abbreviations: dMMR, deficient mismatch repair; HDAC, histone deacetylase; mTOR, mammalian target of rapamycin; PARP, poly-(ADP-ribose) polymerase; PI3K, phosphatidylinositol 3-kinase. Some of these are being planned to be tested in clinical trials for their validity.

34. Ongoing clinical trials Efficacy and Safety of Olaparib in Pretreated Patients With Measurable Colorectal Cancer, Stratified by Microsatellite Instability (MSI) Status - ongoing trial with PARP inhibitors. CINATRA: Chromosomal Instability and Anti-Tubulin Response Assessment: A phase 2 study of Epo906/patupilone in metastatic colon carcinoma in patients with microsatellite instability or chromosomal instability. Exploiting the chromosomal stability of dMMR. Chr instability is associated with taxane resistance. We have also demonstrated a correlation between chromosomal numerical heterogeneity and taxane resistance in breast and colon cancer cell lines. Taken together with published work documenting the association of taxane resistance with aberrations in the spindle assembly checkpoint and the ability of near diploid microsatellite instability positive cell lines to arrest more efficiently in response to microtubule disruption than cell lines with chromosomal instability, we suggest this could be a compelling reason for the failure of taxanes to display activity in colorectal cancer with high frequency CIN.Exploiting the chromosomal stability of dMMR. Chr instability is associated with taxane resistance. We have also demonstrated a correlation between chromosomal numerical heterogeneity and taxane resistance in breast and colon cancer cell lines. Taken together with published work documenting the association of taxane resistance with aberrations in the spindle assembly checkpoint and the ability of near diploid microsatellite instability positive cell lines to arrest more efficiently in response to microtubule disruption than cell lines with chromosomal instability, we suggest this could be a compelling reason for the failure of taxanes to display activity in colorectal cancer with high frequency CIN.

36. Conclusions dMMR CRC is a distinct subtype that displays a well-defined histopathological and therapeutic profile. The predictive and prognostic role can aid the oncologist substantially in clinical practice. The emerging data from well- designed clinical trials should be able to provide further support for its clinical utility and implementation. It may be equally important to target the secondary mutations in addition to the primary dMMR mutations. Better understanding of its molecular mechanisms will hopefully pave the way for novel drug development strategies based on specific molecular subtypes. dMMR is a heterogenous group- need to develop homogenous models – to validate preclinical studies Targeting primary and secondary mutations in combination should also be exploited therapeutically.dMMR is a heterogenous group- need to develop homogenous models – to validate preclinical studies Targeting primary and secondary mutations in combination should also be exploited therapeutically.

37. References Microsatellite instability in colorectal cancer-the stable evidence. Vilar E, Gruber SB Nat Rev Clin Oncol. 2010 Mar The hereditary nonpolyposis colorectal cancer syndrome: genetics and clinical implications. Chung DC, Rustgi AK. Ann Intern Med. 2003 Apr Mismatch repair deficient colorectal cancer in the era of personalized treatment.Hewish M, Lord CJ, Martin SA, Cunningham D, Ashworth A. Nat Rev Clin Oncol. 2010 Feb 23. Immunohistochemical pattern of MLH1/MSH2 expression is related to clinical and pathological features in colorectal adenocarcinomas with microsatellite instability. Lanza G, Gafà R, Maestri I, Santini A, Matteuzzi M, Cavazzini L Mod Pathol. 2002 Jul; Tumor microsatellite instability and clinical outcome in young patients with colorectal cancer. Gryfe R, Kim H, Hsieh ET, Aronson MD, Holowaty EJ, Bull SB, Redston M, Gallinger S. N Engl J Med. 2000 Jan Screening for the Lynch syndrome (hereditary nonpolyposis colorectal cancer). Hampel H, Frankel WL, Martin E, Arnold M, Khanduja K, Kuebler P, Nakagawa H, Sotamaa K, Prior TW, Westman J, Panescu J, Fix D, Lockman J, Comeras I, de la Chapelle A. N Engl J Med. 2005 May

38. Colorectal cancer due to deficiency in DNA mismatch repair function: a review. Bellizzi AM, Frankel WL. Adv Anat Pathol. 2009 Nov Microsatellite instability. de la Chapelle A. N Engl J Med. 2003 Jul Molecular origins of cancer: Molecular basis of colorectal cancer. Markowitz SD, Bertagnolli MM. N Engl J Med. 2009 Dec Systematic review of microsatellite instability and colorectal cancer prognosis. Popat S, Hubner R, Houlston RS. J Clin Oncol. 2005 Jan 20 Does microsatellite instability predict the efficacy of adjuvant chemotherapy in colorectal cancer? A systematic review with meta-analysis. Des Guetz G, Schischmanoff O, Nicolas P, Perret GY, Morere JF, Uzzan B. Eur J Cancer. 2009 Jul;45(10): Microsatellite instability does not predict the efficacy of chemotherapy in metastatic colorectal cancer. A systematic review and meta-analysis. Des Guetz G, Uzzan B, Nicolas P, Schischmanoff O, Perret GY, Morere JF. Anticancer Res. 2009 May;29 E5202: The GI Intergroup Strategy for Stage II Colon Cancer Patients .The quest for individualized patient therapy. by Al B. Benson III, Oncology Issues March/April 2007