martin-butler
Uploaded by
11 SLIDES
228 VUES
110LIKES

DNA Replication and Protein Synthesis: Molecular Biology Processes

DESCRIPTION

Learn about DNA replication at different rates, anti-parallel DNA strands, protein synthesis steps such as transcription, splicing, and translation, and post-translational processing in molecular biology. Understand how RNA polymerase transcribes DNA and how amino acids form proteins.

1 / 11

Télécharger la présentation

DNA Replication and Protein Synthesis: Molecular Biology Processes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Coding regions

  2. DNA replication takes place at the rate of 50 nucleotides per second in eukaryotes and 500 per second in prokaryotes • The DNA strands are anti-parallel

  3. A polynucleotide chain consists of a series of 5’-3’ sugar-phosphate links that form a backbone from which the bases protrude

  4. Replication proceeds in the 5’ to 3’ direction

  5. Birth of a protein

  6. Transcription – splicing – translation

  7. Figure 3. A schematic drawing of the entire process of protein synthesis. An RNA Polymerase binds to a promoter region of DNA, and begins the transcription process, which continues until a stop codon is reached. The product is an RNA molecule called the primary transcript, which contains regions that code for proteins (exons) and regions, which do not (introns). The introns are spliced out at splicosomes, and the joined exons are transported to a ribosome. There, transfer RNAs match amino acids to the appropriate codons in the RNA; the amino acids form peptide bonds and become an unfolded protein. The protein then folds into local formations like helices and sheets, and forms internal bonds across longer distances. Post-translational processing can add additional substance; e.g., glycosylation adds sugar molecules to the protein.

  8. DNA: CGAACAAACCTCGAACCTGCT Translation Some Basic Molecular Biology Transcription mRNA: GCU UGU UUA CGA Polypeptide: Ala Cys Leu Arg

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer