DNA Replication and Protein Synthesis: Molecular Biology Processes
Learn about DNA replication at different rates, anti-parallel DNA strands, protein synthesis steps such as transcription, splicing, and translation, and post-translational processing in molecular biology. Understand how RNA polymerase transcribes DNA and how amino acids form proteins.
DNA Replication and Protein Synthesis: Molecular Biology Processes
E N D
Presentation Transcript
DNA replication takes place at the rate of 50 nucleotides per second in eukaryotes and 500 per second in prokaryotes • The DNA strands are anti-parallel
A polynucleotide chain consists of a series of 5’-3’ sugar-phosphate links that form a backbone from which the bases protrude
Figure 3. A schematic drawing of the entire process of protein synthesis. An RNA Polymerase binds to a promoter region of DNA, and begins the transcription process, which continues until a stop codon is reached. The product is an RNA molecule called the primary transcript, which contains regions that code for proteins (exons) and regions, which do not (introns). The introns are spliced out at splicosomes, and the joined exons are transported to a ribosome. There, transfer RNAs match amino acids to the appropriate codons in the RNA; the amino acids form peptide bonds and become an unfolded protein. The protein then folds into local formations like helices and sheets, and forms internal bonds across longer distances. Post-translational processing can add additional substance; e.g., glycosylation adds sugar molecules to the protein.
DNA: CGAACAAACCTCGAACCTGCT Translation Some Basic Molecular Biology Transcription mRNA: GCU UGU UUA CGA Polypeptide: Ala Cys Leu Arg