molly-roy
Uploaded by
1 SLIDES
142 VUES
10LIKES

kD a

DESCRIPTION

A). CTA TCT CC T GAA GAG GAA GAG AAA CGG AGA A TC C GA AGG GAA CGG AA T AAG ATG GCT GCA GCC AAG TGC CGG AAT C GG AGG AGG GAG CTG ACA GAT ACA CTC CAA GCG gta ggt tga accagctgctgctcctgaa actttattaaagttggagcttgggactatgggcgcagggtcct tgagcatgcccgtgtctatgctttcttatatctctccctatgc

1 / 1

Télécharger la présentation

kD a

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. A) CTA TCT CCT GAA GAG GAA GAG AAA CGG AGA ATCCGA AGG GAA CGG AAT AAG ATG GCT GCA GCC AAGTGC CGG AAT CGG AGG AGG GAG CTG ACA GAT ACACTC CAA GCG gta ggt tga accagctgctgctcctgaa actttattaaagttggagcttgggactatgggcgcagggtcct tgagcatgcccgtgtctatgctttcttatatctctccctatgc ag GAG ACA GAT CAA CTT GAA GAT GAG AAG TCT B) kDa CE-0 CE-30 E-30 75 c-Fos 50 37 25 20 GAPDH

More Related