noble-kidd
Uploaded by
88 SLIDES
1022 VUES
880LIKES

Understanding RNA Structure and Its Biological Significance

DESCRIPTION

This comprehensive overview explores the structure of RNA and its crucial roles in biological systems. It covers the basics of RNA composition, the formation of secondary and tertiary structures, and the various methods used to predict RNA conformations, such as the Minimum Free-Energy method. Additionally, the document discusses the importance of RNA in processes such as mRNA splicing and ribosome function. The information draws upon key sources in molecular biology, aiming to enhance the understanding of RNA's significance in cellular functions.

1 / 88

Télécharger la présentation

Understanding RNA Structure and Its Biological Significance

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to be discovered. This seems highly unlikely. —F. Crick (1958)

  2. Contents • Basics • RNA structure • Prediction • RNA structure in biology • RNA efferencing

  3. Cell Source: “Molecular Cell Biology” by Lodish et al.

  4. Source: “Biology” by Campbell & Reece

  5. Cellular macromolecules Source: “Molecular Cell Biology” by Lodish et al.

  6. All nucleotides have a common structure Source: “Molecular Cell Biology” by Lodish et al.

  7. There are five principal bases in nucleic acids A, G, T, C are present in DNA A, G, U, C are present in RNA Source: “Molecular Cell Biology” by Lodish et al.

  8. Nucleotide subunits are linked together by phosphodiester bonds Source: “Molecular Cell Biology” by Lodish et al.

  9. Nucleotide terminology Source: “Molecular Cell Biology” by Lodish et al.

  10. Native DNA is a double helix of complementary anti-parallel chains Hydrogen bonding between complementary base pairs (A-T or G-C) holds the two strands together Source: “Molecular Cell Biology” by Lodish et al.

  11. DNA can undergo reversible strand separation Source: “Molecular Cell Biology” by Lodish et al.

  12. Source: “Biology” by Campbell & Reece

  13. Source: “Molecular Cell Biology” by Lodish et al.

  14. Contents • Basics • RNA structure • Prediction • RNA 2nd structure in biology • RNA efferencing

  15. Complementary sequences in RNA molecules maintain RNA secondary structure. Source: “Bioinformatics” by David W. Mount

  16. Features of RNA Secondary Structure • In DNA, G≡C A=T • In RNA, G≡C A=U G=U

  17. Features of RNA Secondary Structure Primary structure ↓ Secondary Structure ↓ Tertiary Structure

  18. Types of single- & double-stranded regions in RNA secondary structures. Source: “Bioinformatics” by David W. Mount

  19. Interaction of RNA secondary structural elements. Source: “Bioinformatics” by David W. Mount

  20. Display of base pairs in an RNA secondary structure by a circle plot. Source: “Bioinformatics” by David W. Mount

  21. Contents • Basics • RNA structure • Prediction • RNA structure in biology • RNA efferencing

  22. Prediction • Minimum Free-Energy Method • Sequence Co-variation

  23. Global alignment L G P S S K Q T G K G S – S R I W D N | | | | | | | L N – I T K S A G K G A I M R L G D A Local alignment - - - - - - - - T G K G - - - - - - - | | | - - - - - - - - A G K G - - - - - - - Adapted from “Bioinformatics” by D W Mount

  24. Dotplot DOROTHY--------HODGKIN DOROTHYCROWFOOTHODGKIN Adapted from “Introduction to Bioinformatics“ by A M Lesk

  25. Drosophila melanogaster SLIT protein against itself http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html

  26. Dotplot A G C T A G G A | | | | | C A C T A G G C

  27. 5’ A C G U - - - - G C G U 3’ | | | | 3’ U G C G - - - - U G C A 5’

  28. Source: “Bioinformatics” by David W. Mount

  29. Source: “Bioinformatics” by David W. Mount

  30. RNA 2nd Structure Website http://www.bioinfo.rpi.edu/~zukerm/rna/

  31. Prediction • Minimum Free-Energy Method • Sequence Co-variation

  32. Source: “Bioinformatics” by David W. Mount

  33. Source: “Bioinformatics” by David W. Mount

  34. RNA 2nd Structure Website http://www.genebee.msu.su/services/rna2_reduced.html

  35. 1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC---- 2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA 3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA

  36. 1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC---- 2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA 3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA

  37. Limitations of Prediction-Assumption • The most likely structure is similar to the energetically most stable structure. • The energy associated with any position in the structure is only influenced by local sequence and structure. • The structure is assumed to be formed by folding of the chain back on itself in a manner that does not produce any knots. Source: “Bioinformatics” by David W. Mount

  38. Contents • Basics • RNA structure • Prediction • RNA structure in biology • RNA efferencing

  39. RNA 2nd structure in Biology • Nuclear RNA splicing • Group I/II intron splicing • Ribosome • RNA sensor

  40. Processing of eukaryotic mRNA Source: “Molecular Cell Biology” by Lodish et al.

  41. Source: “Molecular Cell Biology” by Lodish et al.

  42. Source: “Gene VII” by Lewin

  43. Interaction of the RNP motif from U1A protein and RNA Figure 11-10 Source: “Molecular Cell Biology” by Lodish et al.

  44. hnRNP proteins may assist in processing and transport of mRNAs Figure 11-11 Source: “Molecular Cell Biology” by Lodish et al.

  45. Splicing occurs at short, conserved sequences Consensus sequences around 5 and 3 splice sites in vertebrate pre-mRNA Figure 11-14 Source: “Molecular Cell Biology” by Lodish et al.

More Related