1 / 16

Translation

Translation. Need message mRNA Need translator molecule tRNA Need site ribosome rRNA + protein. tRNA. transcribed from DNA binds to other nucleic acids binds to amino acids. Charging of tRNA. attaching amino acid to 3’ end requires specific enzyme requires energy.

Télécharger la présentation

Translation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Translation • Need message • mRNA • Need translator molecule • tRNA • Need site • ribosome • rRNA + protein

  2. tRNA • transcribed from DNA • binds to other nucleic acids • binds to amino acids

  3. Charging of tRNA • attaching amino acid to 3’ end • requires specific enzyme • requires energy aminoacyl tRNA:

  4. The Genetic Code • Non-overlapping • one base belongs to one codon only • every three bases “read” as one codon • No “punctuation” • no bases skipped • Special start and stop codons • AUG = start signal • UGA, UAA, UAG = stop signals

  5. Reading Frames 5’ C C G U A U G C G G A A C U C C A U G G G A A G First amino acid in any polypeptide chain is methionine (formylmethionine – prokaryotes)

  6. Ribosome A = aminoacyl site P = peptidyl site Small subunit P A Large subunit P = “donor” site A = “entry” site (E = “exit” site)

  7. P A 5

  8. 5’ CAGGAAGCGAUGGGCUCGACAUGCGA… Shine-Dalgarno Sequence (prokaryotes) or Scanning Hypothesis (eukaryotes)

  9. UAC UAC met met 5’ AUG

  10. CCG CCG gly gly 5’ GGC AUG UAC met | met

  11. AGC AGC ser ser AUG GGC UCG CCG gly met gly met

  12. UGU UGU thr thr AUG GGC UCG ACA AGC ser gly met ser glu met

  13. ACA UGA UGU Release factors thr ser glu met

  14. ACA UGA UGU Release factors thr ser glu met

  15. ACA UGA Release factors UGU thr ser glu met

  16. thr ser glu met

More Related