rnarvaez
Uploaded by
63 SLIDES
658 VUES
630LIKES

Chapter 17 Pre Lecture Assignment

DESCRIPTION

Understand the roles of DNA and RNA, the process of transcription and translation, and the significance of gene expression in protein synthesis. Learn about the various types of RNA and how genetic information is translated into proteins. Dive into transcription units, genetic codes, and the steps involved in transcription and translation in prokaryotes and eukaryotes. Explore concept 17.1 and 17.2 focusing on genes, protein synthesis, and RNA transcription, with a special emphasis on the central dogma of molecular biology.

1 / 63

Télécharger la présentation

Chapter 17 Pre Lecture Assignment

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 17Pre Lecture Assignment • Compare and contrast DNA to RNA. • What is the difference between replication, transcription and translation?

  2. Nucleic Acids DNA RNA • Double-stranded • Deoxyribose • Thymine • Template for individual • Single-stranded • Ribose • Uracil • Many different roles!

  3. RNA plays many roles in the cell • pre-mRNA=precursor to mRNA, newly transcribed and not edited • mRNA= the edited version; carries the code from DNA that specifies amino acids • tRNA= carries a specific amino acid to ribosome based on its anticodon to mRNA codon • rRNA= makes up 60% of the ribosome; site of protein synthesis • snRNA=small nuclear RNA; part of a spliceosome. Has structural and catalytic roles • srpRNA=a signal recognition particle that binds to signal peptides • RNAi= interference RNA; a regulatory molecule • ribozyme= RNA molecule that functions as an enzyme

  4. Chapter 17 Pre Lecture Assignment 3. Describe the steps in transcription. 4. Contrast transcription in prokaryotes vs. eukaryotes. 5. How many nucleotides are in an mRNA molecule to code for a protein with 200 amino acids?

  5. Chapter 17Pre Lecture Assignment 6. Describe the steps of translation. 7. If the DNA sequence is: 3’ T A C G A T C A G 5’ • the cDNA would be: • the mRNA is: • the tRNA is: • the amino acid sequence is: 8. How does the cell determine the ultimate destination of a polypeptide being synthesized?

  6. AP Practice Question – Chapter 16 A biochemist isolates, purifies, and combines in a test tube a variety of molecules needed for DNA Replication. When she adds some DNA to the mixture, replication occurs, but each DNA molecule consists of a normal strand paired with numerous segments of DNA a few hundred nucleotides long. What has she probably left out of the mixture? DNA Polymerase Helicase Primase Ligase

  7. From Gene to Protein Chapter 17

  8. What you need to know: • The key terms: gene expression, transcription, and translation. • The major events of transcription. • How eukaryotic cells modify RNA after transcription. • The steps to translation. • How point mutations can change the amino acid sequence of a protein.

  9. Concept 17.1:Genes specify proteins via transcription and translation

  10. Gene Expression: process by which DNA directs the synthesis of proteins (or RNAs) • Old idea: one gene-one enzyme hypothesis • Proposed by Beadle & Tatum – mutant mold experiments • Function of a gene = dictate production of specific enzyme • Newer idea: one gene-one polypeptidehypothesis Most accurate: one gene-one RNA molecule (which can be translated into a polypeptide)

  11. Flow of genetic information • Central Dogma: DNA  RNA  protein • Transcription: DNA  RNA • Translation: RNA  protein • Ribosome = site of translation

  12. Sharing the Genetic Code Biotechnology Ch. 20

  13. Transcription and Translation nucleus transcription ribosome DNA mRNA replication translation protein trait cytoplasm

  14. Flow of Genetic Information in Prokaryotes vs. Eukaryotes

  15. Concept 17.2:Transcription is the DNA-directed synthesis of RNA

  16. Transcription Transcription unit: stretch of DNA that codes for a polypeptide or RNA (eg. tRNA, rRNA) RNA polymerase: • Separates DNA strands, and transcribes mRNA • mRNA elongates in 5’ 3’ direction • Uracil (U) replaces thymine (T) when pairing to adenine (A) • Attaches to promoter (start of gene) and stops at terminator (end of gene)

  17. RNA polymerase Matching bases of DNA & RNA A • RNA Polymerase match RNA bases to DNA bases on one of the DNA strands • No primer needed (like for DNA replication) C U G A G G U C U U G C A C A U A G A C U A G C C A T G G T A C A G C T A G T C A T C G T A C C G T

  18. Matching bases of DNA & RNA • U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA

  19. The Genetic Code For each gene, one DNA strand is the template strand mRNA (5’ 3’) complementary to template mRNA triplets (codons) code for amino acids in polypeptide chain

  20. The Genetic Code 64 different codon combinations Redundancy: 20 AAs Reading frame: groups of 3 must be read in correct groupings This code is universal: all life forms use the same code.

  21. 1. Initiation Bacteria: RNA polymerase binds directly to promoter in DNA – it just hops right on board Eukaryotes: RNA Pol needs directions from transcription factors

  22. 1. Initiation Eukaryotes: TATA box = DNA sequence (TATAAAA) upstream from promoter Transcription factors mustrecognize TATA box before RNA polymerase can bind to DNA promoter

  23. 2. Elongation • RNA polymerase adds RNA nucleotides to the 3’ end of the growing chain (A-U, G-C)

  24. 2. Elongation As RNA polymerase moves, it untwists DNA, then rewinds it after mRNA is made

  25. 3. Termination Prokaryotes = mRNA breaks free at the terminator sequence, ready for use Eukaryotes: RNA polymerase transcribes a terminatorsequence (signal) and the pre-mRNA strand is cleaved off by proteins It is now called pre-mRNA for eukaryotes. (mRNA)

  26. End

  27. February 8, 2016 • Agenda: • RNA Processing • Translation • Practice • Reminder: • Ch 16 Quiz Tmrw • I am not after school • HW: Chapter 16 and 17 Review Worksheet

  28. The Central Dogma cytoplasm nucleus transcription translation protein trait

  29. Concept 17.3:Eukaryotic cells modify RNA after transcription

  30. RNA Processing • Before RNA can go to the cytoplasm, • Altered • Interior sections get cut out • Remaining parts get spliced together

  31. Alteration of the Ends • 5’ end gets a 5’ cap(modified guanine) and • 3’gets poly-A tail (50-520 A’s)are added • Help export from nucleus, protect from enzyme degradation, attach to ribosomes

  32. RNA Splicing “Cut and Paste” • Pre-mRNA has introns (noncoding sequences of DNA) and exons (codes for amino acids) • Splicing = introns cut out, exons joined together

  33. Introns – interveneExons - eventually expressed or exit the nucleus

  34. RNA Splicing • Spliceosomescatalyze the process of removing introns and joining exons • Made of proteins and small bits of RNA • Discovery of a catalytic RNA called Ribozyme (acts as enzyme) • small nuclear ribonucleoproteins = snRNPs • Pronounced “snurps” • Recognize splice sites

  35. Evolution: Why have introns? • Some regulate gene activity • Alternative RNA Splicing: produce different combinations of exons • Males/Females splice different sections • One gene can make more than one polypeptide! • 20,000 genes  100,000 polypeptides • Exon shuffling, give room for crossing over to occur

  36. RNA Splicing Video

  37. Concept 17.4:Translation is the RNA-directed synthesis of a polypeptide

  38. Flow of Genetic Information in Prokaryotes vs. Eukaryotes

  39. Components of Translation • mRNA = message • tRNA= interpreter • Ribosome = site of translation Read the DNA Message and make protein chains!

  40. tRNA • Transcribed in nucleus • Specific to each amino acid • Transfer AA floating the cytoplasm to ribosomes • Anticodon: pairs with complementary mRNA codon • Base-pairing rules between 3rd base of codon & anticodon are not as strict. This is called wobble.

  41. Ribosomes Active sites: • A site: holds AA to be added • P site: holds growing polypeptide chain • E site: exit site for tRNA

  42. Translation:1. Initiation • Small subunit binds to start codon (AUG) on mRNA • tRNA carrying Met attaches to P site • Large subunit attaches

  43. 2. Elongation

  44. 2. Elongation Codon recognition: tRNA anticodon matches codon in A site

  45. 2. Elongation Peptide bond formation: AA in A site forms bond with peptide in P site

  46. 2. Elongation Translocation: tRNA in A site moves to P site; tRNA in P site moves to E site (then exits)

  47. 2. Elongation Repeat over and over

  48. 3.Termination • Stop codon reached and translation stops • Release factor binds to stop codon; polypeptide is released • Ribosomal subunits dissociate

  49. Polyribosomes • A single mRNA can be translated by several ribosomes at the same time

  50. Protein Folding • During synthesis, polypeptide chain coils and folds spontaneously • Chaperonin: protein that helps polypeptide fold correctly

More Related