tallis
Uploaded by
25 SLIDES
533 VUES
260LIKES

2. Protein Synthesis

DESCRIPTION

2. Protein Synthesis. Important Molecules in Making Protein!. DNA – stays in nucleus!. The RNA ’ s – move from nucleus to cytoplasm mRNA tRNA rRNA. Amino acids – stay in cytoplasm. Steps in making a Protein. A. Transcription - in nucleus. B.Translation – in cytoplasm.

1 / 25

Télécharger la présentation

2. Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. 2. Protein Synthesis

  2. Important Molecules in Making Protein! DNA – stays in nucleus! • The RNA’s – move from nucleus to cytoplasm • mRNA • tRNA • rRNA Amino acids – stay in cytoplasm

  3. Steps in making a Protein A. Transcription - in nucleus B.Translation – in cytoplasm

  4. A. Transcription - from DNA to mRNA • Takes place in nucleus of cell • An enzyme (RNA polymerase) • unzips DNA • Starts making an mRNA copy using one strand of DNA as a template LOOK!

  5. Making mRNA – Transcription cont. • Each 3 letters in • DNA (ex. ATG, CTA) directs a particular 3 letters to be formed in mRNA (ex. UAC, • GAU) Remember, this is RNA! • U not T! • Next, mRNA molecules are edited so that final sequence only contains protein-coding information • Each mRNA triplet = codon

  6. Editing mRNA Transcripts • Editing of mRNA transcript begins with • capping of “sticky ends” (G/polyA caps) • Exons remain • Introns spliced out “Mature” mRNA oozes out of nucleus into cytoplasm. NEXT…

  7. Example: Transcribing to mRNA • DNA strand is split by enzymes. • mRNA strand forms from DNA template with help from RNA polymerase (replace T with U) A T A G C C G A T A T U A U C G G C U A U A T A T C G G C T A T A

  8. 2. Translation • Decoding of mRNA into protein takes place on ribosomes in cytoplasm • mRNA attaches to ribosome • A tRNA carrying an amino • acid attaches to mRNA at • a “start” codon = A U G • Another tRNA attaches with another amino acid coded for by mRNA

  9. Translation cont. • Amino acids attach to one another by peptide bonds. • “Polypeptide” or • protein lengthens • Old tRNA leaves • ribosome, new tRNA • comes in. • Protein continues to • grow until “stop” codon reached. LOOK! MORE!

  10. OK, so how do these codons direct a certain amino acid to be brought to the growing protein???

  11. The Genetic Code

  12. Given the following mMRA sequence, what are the amino acids it codes for? A U G A A C C G C A U U U A A MET “Start” ASN ARG ILE STOP

  13. After translation proteins are ready to be used by the cell or body • Remember! Whenever a cell puts its genetic code into action; it is making precisely those proteins that it requires, thus… • If the protein specific for building cell structure or metabolism is damaged, you can expect an abnormal cell.

  14. Mutation Buzzwords… • Point mutation (within gene) • Frameshift mutation (within gene)= Change the reading frame (codons) of a nucleotide sequence. • Chromosomal mutation(affecting part or whole chromosome)

  15. Point Mutations • Substitution = 1 base pair is substituted for another resulting in different “aa” coded for . • Ex. cct (in DNA) = gga (in mRNA) = glycine act = uga = stop • Ex. Sickle cell anemia. Valine (gtg) substituted for glutamate (gag) causes hemoglobin molecule to shrink and become distorted.

  16. Frameshift Mutations • Deletion = loss of one or several nucleotides in DNA sequence ccgatt -> cgctt ggcuaa -> gcgaa = glycine and stop = alanine and ? • Insertions= addition of one or several nucleotides in DNA sequence ccgatt -> ccgagatt ggcuaa -> ggcucuaa • =glycine and stop = glycine+serine+junk

  17. Ex. Inversion ccgatt -> cagctt ggcuaa -> gucgaa = glycine and stop = valine and glutamate Ex. Duplication ccgatt -> ccgagatt ggcuaa -> ggcucuaa • =glycine and stop = glycine+serine+junk

  18. Deletion = deleted base or sequence (Cri du Chat)

  19. Chromosomal Mutations • Nondisjunction = chromosomes don’t separate after meiosis (Down’s Syndrome, Patau’s)

  20. Translocations = pieces of DNA from one chromosome being inserted into another chromosome. (chronic myelogenous leukemia)

  21. Name that Mutation!

  22. TGAGGACTCCTC normal gene TGAGGACACCTC abnormal gene Sickle cell anemia/point mutation/missense

  23. TGCGTCATA normal TGCATCATA abnormal Cystic fibrosis/point mut/nonsense

  24. TCGAAACCGCCGCCGCCGCCGCCGAATTAT normal TCGAAACCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCG…300more..AATTAT abnormal Fragile x syndrome/insertion/duplication/expanding duplication mutation

  25. Name the three types of RNA. Which enzyme attaches free nucleotides to an open strand of DNA in replication? What is an exon? Change the DNA sequence T T A T A A T T C C T A G into a rough mRNA transcript.

More Related