2. Protein Synthesis
2. Protein Synthesis. Important Molecules in Making Protein!. DNA – stays in nucleus!. The RNA ’ s – move from nucleus to cytoplasm mRNA tRNA rRNA. Amino acids – stay in cytoplasm. Steps in making a Protein. A. Transcription - in nucleus. B.Translation – in cytoplasm.
2. Protein Synthesis
E N D
Presentation Transcript
Important Molecules in Making Protein! DNA – stays in nucleus! • The RNA’s – move from nucleus to cytoplasm • mRNA • tRNA • rRNA Amino acids – stay in cytoplasm
Steps in making a Protein A. Transcription - in nucleus B.Translation – in cytoplasm
A. Transcription - from DNA to mRNA • Takes place in nucleus of cell • An enzyme (RNA polymerase) • unzips DNA • Starts making an mRNA copy using one strand of DNA as a template LOOK!
Making mRNA – Transcription cont. • Each 3 letters in • DNA (ex. ATG, CTA) directs a particular 3 letters to be formed in mRNA (ex. UAC, • GAU) Remember, this is RNA! • U not T! • Next, mRNA molecules are edited so that final sequence only contains protein-coding information • Each mRNA triplet = codon
Editing mRNA Transcripts • Editing of mRNA transcript begins with • capping of “sticky ends” (G/polyA caps) • Exons remain • Introns spliced out “Mature” mRNA oozes out of nucleus into cytoplasm. NEXT…
Example: Transcribing to mRNA • DNA strand is split by enzymes. • mRNA strand forms from DNA template with help from RNA polymerase (replace T with U) A T A G C C G A T A T U A U C G G C U A U A T A T C G G C T A T A
2. Translation • Decoding of mRNA into protein takes place on ribosomes in cytoplasm • mRNA attaches to ribosome • A tRNA carrying an amino • acid attaches to mRNA at • a “start” codon = A U G • Another tRNA attaches with another amino acid coded for by mRNA
Translation cont. • Amino acids attach to one another by peptide bonds. • “Polypeptide” or • protein lengthens • Old tRNA leaves • ribosome, new tRNA • comes in. • Protein continues to • grow until “stop” codon reached. LOOK! MORE!
OK, so how do these codons direct a certain amino acid to be brought to the growing protein???
Given the following mMRA sequence, what are the amino acids it codes for? A U G A A C C G C A U U U A A MET “Start” ASN ARG ILE STOP
After translation proteins are ready to be used by the cell or body • Remember! Whenever a cell puts its genetic code into action; it is making precisely those proteins that it requires, thus… • If the protein specific for building cell structure or metabolism is damaged, you can expect an abnormal cell.
Mutation Buzzwords… • Point mutation (within gene) • Frameshift mutation (within gene)= Change the reading frame (codons) of a nucleotide sequence. • Chromosomal mutation(affecting part or whole chromosome)
Point Mutations • Substitution = 1 base pair is substituted for another resulting in different “aa” coded for . • Ex. cct (in DNA) = gga (in mRNA) = glycine act = uga = stop • Ex. Sickle cell anemia. Valine (gtg) substituted for glutamate (gag) causes hemoglobin molecule to shrink and become distorted.
Frameshift Mutations • Deletion = loss of one or several nucleotides in DNA sequence ccgatt -> cgctt ggcuaa -> gcgaa = glycine and stop = alanine and ? • Insertions= addition of one or several nucleotides in DNA sequence ccgatt -> ccgagatt ggcuaa -> ggcucuaa • =glycine and stop = glycine+serine+junk
Ex. Inversion ccgatt -> cagctt ggcuaa -> gucgaa = glycine and stop = valine and glutamate Ex. Duplication ccgatt -> ccgagatt ggcuaa -> ggcucuaa • =glycine and stop = glycine+serine+junk
Chromosomal Mutations • Nondisjunction = chromosomes don’t separate after meiosis (Down’s Syndrome, Patau’s)
Translocations = pieces of DNA from one chromosome being inserted into another chromosome. (chronic myelogenous leukemia)
TGAGGACTCCTC normal gene TGAGGACACCTC abnormal gene Sickle cell anemia/point mutation/missense
TGCGTCATA normal TGCATCATA abnormal Cystic fibrosis/point mut/nonsense
TCGAAACCGCCGCCGCCGCCGCCGAATTAT normal TCGAAACCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCG…300more..AATTAT abnormal Fragile x syndrome/insertion/duplication/expanding duplication mutation
Name the three types of RNA. Which enzyme attaches free nucleotides to an open strand of DNA in replication? What is an exon? Change the DNA sequence T T A T A A T T C C T A G into a rough mRNA transcript.