tave
Uploaded by
15 SLIDES
326 VUES
150LIKES

Protein Synthesis Overview

DESCRIPTION

Protein Synthesis Overview. Sec 5.1 / 5.2. One Gene – One Polypeptide Hypothesis. early 20 th century – Archibald Garrod physician that noticed that some metabolic errors were found in numerous members in a family alkaptonuria – metabolic disorder where tyrosine is not properly broken down

1 / 15

Télécharger la présentation

Protein Synthesis Overview

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Protein SynthesisOverview Sec 5.1 / 5.2

  2. One Gene – One PolypeptideHypothesis • early 20th century – Archibald Garrod • physician that noticed that some metabolic errors were found in numerous members in a family • alkaptonuria – metabolic disorder where tyrosine is not properly broken down • hypothesized that these people had a defective enzyme that usually breaks down tyrosine. He also hypothesized that this enzyme was under the control of a single gene.

  3. 1941 – Beadle & Tatum • first hypothesized that genes and enzymes are somehow related

  4. Beadle & Tatum Expt • Used X-rays to cause bread mold (yeast) to mutate • Wild type (Normal):can survive on minimal medium (agar, inorganic salts, glucose and biotin) • can synthesize all other molecules they need from these simple molecules (e.g. amino acids and nutrients) • Mutant:could not survive on minimal medium • could not synthesize amino acids and nutrients they need because of deficit in specific enzymes

  5. E1 E2 E3 precursor ornithine citrulline arginine examining arginine synthesis

  6. Beadle & Tatum Expt - 3

  7. Beadle & Tatum Conclusions • one mutation corresponded to a change in a single enzyme

  8. As researchers learned more about proteins they made minor revisions to the “one gene-one-enzyme” hypothesis • Not all proteins are enzymes (e.g. keratin – structural protein) • Some proteins are made up of more than one type of polypeptide, each controlled by a different gene (e.g. Hemoglobin – α and β) • More accurately: “one-gene-one-polypeptide”

  9. Central Dogma COMPONENTS LOCATION PROCESS DNA nucleus transcription mRNA cytoplasm translation protein

  10. Nuclear envelope DNA TRANSCRIPTION DNA TRANSCRIPTION mRNA Ribosome Pre-mRNA RNA PROCESSING TRANSLATION mRNA Polypeptide Ribosome TRANSLATION Polypeptide Figure 17.3b Eukaryotes vs. Prokaryotes

  11. 1 3 2 Promoter Transcription unit 5 3 3 5 Start point DNA RNA polymerase Initiation. After RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis at the start point on the template strand. 5 3 3 5 Template strand of DNA Unwound DNA RNA transcript Elongation. The polymerase moves downstream, unwinding the DNA and elongating the RNA transcript 5  3 . In the wake of transcription, the DNA strands re-form a double helix. Rewound RNA 5 3 3 5 3 RNA transcript 5 Termination. Eventually, the RNA transcript is released, and the polymerase detaches from the DNA. 5 3 3 5 3 5 Completed RNA transcript Figure 17.7 Transcription

  12. Gene 2 DNA molecule Gene 1 Gene 3 DNA strand (template) 5 3 A C C T A A A C C G A G TRANSCRIPTION A U C G C U G G G U U U 5 mRNA 3 Codon TRANSLATION Gly Phe Protein Trp Ser Figure 17.4 Amino acid

  13. Second mRNA base U C A G U UAU UUU UCU UGU Tyr Cys Phe UAC UUC UCC UGC C U Ser UUA UCA UAA Stop Stop UGA A Leu UAG UUG UCG Stop UGG Trp G CUU CCU U CAU CGU His CUC CCC CAC CGC C C Arg Pro Leu CUA CCA CAA CGA A Gln CUG CCG CAG CGG G Third mRNA base (3 end) First mRNA base (5 end) U AUU ACU AAU AGU Asn Ser C lle AUC ACC AAC AGC A Thr A AUA ACA AAA AGA Lys Arg Met or start G AUG ACG AAG AGG U GUU GCU GAU GGU Asp C GUC GCC GAC GGC G Val Ala Gly GUA GCA GAA GGA A Glu Figure 17.5 GUG GCG GAG GGG G • A codon in messenger RNA • Is either translated into an amino acid or serves as a translational stop signal

  14. The following is the sequence of a bases on the template strand of DNA in the transcription unit 3’ – GGATCAGGTCCAGGCAATTTAGCATGCCCC – 5’ • Transcribe this sequence into mRNA • List the order of amino acids

  15. Classwork • Section 5.1 (pg. 236) #1-2,4-6 • Section 5.2 (pg. 241) #1-3,5,6, 7,

More Related