Understanding the Code: From Nucleic Acids to Proteins

1. Translation fromnucleic acid languagetoamino acid language

2. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

3. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets called codons: Each codon calls for 1 amino acid

4. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

5. Wobble? What is wobble?

6. CAU GCA UAC Met Arg Val How are the codons matched to amino acids? tRNA finds the correct amino acid that responds to the codon and brings it to the ribosome 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid

7. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

8. Loading tRNA • Aminoacyl tRNA synthetase • enzyme which bonds amino acid to tRNA • bond requires energy • ATP  AMP • bond is unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

9. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

10. Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

11. 3 2 1 Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

12. Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… Protein targeting • Signal peptide • address label start of a secretory pathway

13. Can you tell the story? RNA polymerase DNA aminoacids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNAsynthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

14. enhancer translation start translation stop exons 1000+b 20-30b RNA polymerase DNA UTR UTR introns promoter transcription start transcription stop pre-mRNA 5' 3' 5' 3' mature mRNA The Transcriptional unit (gene?) transcriptional unit (gene) 3' 5' TAC ACT TATA DNA GTP AAAAAAAA

15. Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst…no nucleus! Cell membrane Cell wall

16. Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes intronscome out! eukaryotic DNA

17. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

18. Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • no RNA processing

19. Any Questions?? What color would a smurf turnif he held his breath?