wright
Uploaded by
36 SLIDES
625 VUES
370LIKES

Transcription

DESCRIPTION

Transcription. RNA. DNA. The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template Separates storage from use Provides a control point for regulation Amplification step (can make many RNA copies). H.

1 / 36

Télécharger la présentation

Transcription

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Transcription RNA DNA • The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template • Separates storage from use • Provides a control point for regulation • Amplification step (can make many RNA copies) H 5’-…TGAGTCACTGTACGCTATATAAGGC…GATCGCCTCAGGAACCACCATGCT…-3’ 3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’

  2. Nucleic acid structure • Natural DNA adopts a linear double helical form • complete complementary base-pairing between two strands • RNA “transcripts” yield complex overall shapes • synthesized as single strands that fold back upon themselves • “folding’ is driven by base pairing note G:U pair

  3. General outline of transcription (txn) • Transcription (Txn) process consists of 5 general steps • BINDING • RNA polymerase (RNAp) binds to DNA in promoter region • UNWINDING • Duplex DNA must be unwound to expose bases of template strand • INITIATION • Polymerize nucleotides one at a time into complementary RNA strand • ELONGATION • Disengage from “additional factors” and the promoter region to continue transcript synthesis throughout full length of gene • TERMINATION • Respond to “stop” signals at the end of the gene by stopping synthesis and releasing the RNA transcript product

  4. Co- factor Binding Txn factor RNAp 5’-…TGAGTCACTGTACGCTATATAAGGC…GATCGCCTCAGGAACCACCATGCT…-3’ 3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’ • RNA polymerase (RNAp) binds to DNA in Promoter region • Bind to specific sequences or “elements” • Additional factors help RNAp recognize promoters • TXN factors • General Txn Factors (GTFs): used at all promoters • Activators/Repressors: used at specific promoters • Bind specific sequence “elements” • Directly or indirectly affect RNAp

  5. Co- factor UNWINDING Txn factor RNAp CGCCTCAGGAACCA T C 5’-…TGAGTCACTGTACGCTATATAAGGC…GA 3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’ CATGCT…-3’ • Duplex must be unwound to expose bases of template strand • Helicase: enzyme that unwinds duplex regions of polynucleotides • DNA helicases act on DNA strands • In txn (see below) and DNA replication (not covered) • RNA helicases act on RNA strands • In a variety of settings, including transcriptional regulation

  6. Co- factor INITIATION Txn factor RNAp CGCCTCAGGAACCA T C 5’-…TGAGTCACTGTACGCTATATAAGGC…GA 3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’ CATGCT…-3’ GCCUCAGGAA-3’ • Start polymerizing nucleotides one at a time into an RNA strand that is complementary to the template DNA strand • Template DNA is “read” in 3’ --> 5’ direction • The RNAtranscript is synthesized in 5’ --> 3’ direction RNAn + NTP --> RNAn+1 + pyrophosphate (PPi) PPi --> 2 inorganic phosphate (Pi) • A short 10-12nt region of RNA-DNA hybrid is created and maintained

  7. Co- factor ELONGATION Txn factor ACCACCATGCT…-3’ A 5’-…TGAGTCACTGTACGCTATATAAGGC…GATCGCCTCAGG 3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’ ACCACCAUGC-3’ • Disengagement of RNAp from various GTFs, cofactors and the promoter region is often called “Promoter Escape” • After disengaging, RNAp continues transcript synthesis throughout full length of gene • A short 10-12nt region of RNA-DNA hybrid is maintained • Transcribed region of DNA is allowed to re-anneal (close), displacing the RNA strand • RNAp moves 3’ --> 5’ on the DNA template strand • Note movement is 5’ --> 3’ on the non-template DNA strand GCCUCAGGA

  8. TERMINATION CAATAAACTAAATTATTA A C 5’-…CCATGCT CTTATGTACGTAGCGACT…-3’ 3’-…GGTACGATGTTATTTGATTTAATAATGGAATACATGCATCGCTGA…-5’ AGAAUAAACU-3’ • Respond to “stop” signal sequences indicating the end of the gene • stop synthesis (a pause in the polymerization reaction) • release the RNA transcript product • Release RNAp from the DNA CCAUGCU

  9. Bacterial txn • RNAp “core” enzyme (no promoter specificity) • 5 subunits capable of binding DNA & RNA synthesis • Sigma factors target RNAp to different types of promoters • Sigma70 is for “housekeeping” and most other genes -35 element “TTGACA” -10 element “TATAAT” • Sigma32 is for “heat shock” genes • Chaperone genes induced in response to excess heat

  10. BACTERIA: • BIND • UNWIND • INITIATE • ELONGATE without sigma

  11. Rho BACTERIA • TERMINATE • Rho-dependent • Rho protein (helicase) unwinds RNA-DNA duplex causing release of finished RNA transcript • Rho-independent • Rho protein is not required • DNA “terminator” sequence causes RNAp to pause, release from DNA and release RNA transcript

  12. Txn in eukaryotes • Three different RNAp enzymes: RNApI, RNApII, RNApIII • All eukaryotic RNAs require additional processing steps after synthesis to yield the mature RNA • Primary RNA transcripts are often called “pre-RNAs”

  13. Txn in eukaryotes: RNApI • 100s of copies of the large ribosomal RNA (rRNA) genes in most genomes • Large numbers needed to yield large amounts of RNA • Copies are grouped into clusters called rDNA • For example, humans have 5 rDNA clusters • rDNA clusters are grouped within the nucleus to form the nucleoli • Nucleoli are the site of rRNA synthesis, processing and ribosome assembly 18S 5.8S 28S 18S 5.8S 28S 18S 5.8S 28S

  14. Txn in eukaryotes: RNApI • RNApI molecules, densely packed on DNA template • Very high rate of rRNA synthesis • pre-rRNA must be processed to yield mature rRNA 18S 5.8S 28S 18S 5.8S 28S 18S 5.8S 28S

  15. Txn in eukaryotes: RNApIII • RNApIII can recognize as “promoter” sequences, regions internal to the transcription unit • Specific General Transcription Factors (GTFs) enable promoter binding • TFIIIA, TFIIIC (Note, there are GTFs for RNApI also, TFIA, etc…) GTF RNAp CGCCTCAGGAACCA T C 5’-…TACGCTGTCTAGGCGA 3’-…ATGCGACAGATCCGCTAGCGGAGTCCTTGGTGGCATAGGAGTTAGGGA…-5’ CGTATCCTCAATCCCT…-3’

  16. Txn in eukaryotes: RNApIII • Transcribe 5S rRNA genes • Product transported to nucleoli for processing/assembly into ribosomes • Transcribe tRNA genes • Exist in genomic clusters • Clusters contain a variety of different tRNAs • Total number of tRNA genes can be very high • (e.g. ~275 in yeast, ~1300 in humans) • Primary tRNA transcripts require processing to mature form • Processing involves cutting and trimming reactions

  17. Txn in eukaryotes: RNApII • For messenger RNA (mRNA),microRNA (miRNA) genes • 12 subunits = coreRNApII enzyme • Promoter specificity requires 6 additional GTFs • TFIID, TFIIA, TFIIB, TFIIF, TFIIE, TFIIH • TATA box, at -24 to -32 matches closely to “TATATAA” • TFIID contains the TATA Binding Protein (TBP)

  18. RNApIItxn BIND • TFIID, via TBP, binds TATA box DNA sequence • TFIIA & TFIIB add next, assemble with some DNA sequence selectivity • A TFIIF-RNApII complex binds • TFIIE & TFIIH bind to complete the “pre-initiation complex”

  19. RNApIItxn UNWIND • TFIIH contains a helicase subunit for unwinding the promoter region INITIATE • Synthesize 10-12nts ELONGATE • TFIIH contains two kinase subunits that phosphorylate the C-terminal Domain (CTD) of RNApII CTD repeat: YSPTSPS • Breaks contacts w/ promoter

  20. RNApII transcript processing • mRNA structure • 5’-end is “capped” • Capping enzymes bind to phospho-CTD of RNApII • Unusual 5’ -- 5’ linkage of 7-methylG-PPP • Protects 5’-end from exonucleases • Enhances nuclear export • Enhances mRNA tln

  21. RNApII transcript processing • mRNA structure • 5’-untranslated region (UTR) • Regulation of translation (TLN) and stability • Coding region • Sequence of nucleotides continuously encoding a protein • Also called an ‘open reading frame’ (ORF) • 3’-UTR • Regulation of translation (TLN) and stability

  22. mRNA structure • 3’-end is polyadenylated • Requires a large protein complex • (e.g. CPSF, CStF) • Recognizes 5’-AAUAAA-3’ sequence in primary transcript • Cleaves pre-RNA ~20nt downstream of AAUAAA • PolyA polymerase adds 50-250 adenosines at new 3’-end • Protects 3’-end from exonucleases TERMINATE • Recognition of AAUAAA coupled with RNApII destabilization • Cleavage effectively releases pre-RNA from RNApII • RNApII with reduced processivity falls off DNA template

  23. RNApII transcript processing • Primary transcripts for protein coding genes (hnRNAs) are much larger than their corresponding mRNAs • Heteronuclear RNAs • Localized to the cell nucleus • Contain “exon” sequences • Contain “intron” sequences • mRNAs • Localized to the cell cytoplasm • Contain only “exon” sequences • RNA splicing • Removal of introns • Joining exons together

  24. RNApII transcript processing: splicing • Exons can be either protein coding or 5’-/3’-UTR sequences • Exons contribute to the final mRNA product • ~150nts each • Intervening sequences between exons are introns • Introns must be removed to yield the final mRNA product • ~3500nts each

  25. RNApII transcript processing: splicing • Specific RNA sequences demarcate the exon/intron borders • Subunits of the “spliceosome” recognize these “exon junctions”

  26. The spliceosome catalyzes two reactions that eliminate the intron and join upstream and downstream exons together

  27. How does the cell machinery determine which exons to splice together? • Which ones should be made? Exon 1 Exon 2 Exon 3 Exon 4 Exon 1 Exon 2 Exon 3 Exon 4 ? ? Exon 1 Exon 3 Exon 4 ? Exon 1 Exon 2 Exon 4 ?

  28. Spliceosomes are assembling on pre-RNA during Elongation • Provides mechanism to avoid confusing which exons go together • Sequential assembly of spliceosomes as pre-RNA is synthesized helps assure no exon/intron junctions are accidentally missed

  29. Alternative splicing • Not all exons have “ideal” exon/intron splicing sequences • Not all are efficiently recognized by spliceosome • Exonic Splicing Enhancer (ESE) sequences • Binding factors can promote use of an exon/intron junction - ESE binding protein + ESE binding protein Exon 1 ESE Exon 3 Exon 4 Exon 1 Exon 3 Exon 4 Exon 1 ESE Exon 3 Exon 4

More Related