Samuel
Uploaded by
83 SLIDES
1488 VUES
850LIKES

Mapping

DESCRIPTION

Mapping. Nucleic Acids and Proteins. Mapping. Restriction Mapping Open Reading Frames Peptide Mapping T1 Ribonuclease maps FingerPrint Plasmid Maps PlasmidMap. Restriction Maps. Map MapSort MapPlot. Peptide Maps. PeptideMap PeptideSort. Restriction Enzyme Mapping.

1 / 83

Download Presentation
Télécharger la présentation

Mapping

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Mapping Nucleic Acids and Proteins

  2. Mapping • Restriction Mapping • Open Reading Frames • Peptide Mapping • T1 Ribonuclease maps • FingerPrint • Plasmid Maps • PlasmidMap

  3. Restriction Maps • Map • MapSort • MapPlot

  4. Peptide Maps • PeptideMap • PeptideSort

  5. Restriction Enzyme Mapping

  6. Restriction Enzyme Data • REBASE • Dr. Richard J. Roberts CSHL, NEB • Release 003 3/2000 • http://rebase.neb.com • enzyme.dat • Enzyme • Cutting Characteristics • Sources • References

  7. Restriction Enzyme Information • Sources • GenMoreData:enz_sources.txt • Letter in enzyme.dat refers to source • References • GenMoreData:enz_refs.txt • Use number listed by enzyme in enzyme.dat

  8. enz_sources.txt REBASE version 003 commdata.003 =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= REBASE, The Restriction Enzyme Database http://rebase.neb.com Copyright (c) Dr. Richard J. Roberts, 2000. All rights reserved. =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= Rich Roberts Mar 01 2000 :::::::::::::::::::::::::::::: RESTRICTION ENZYMES AND METHYLASES COMMERCIALLY AVAILABLE AS OF Wed, Mar 01, 2000 ::::::::::::::::::::::::::::::

  9. Advanced Biotechnologies Ltd. (REBASE abbr: T) Unit 7, Mole Business Park 3, Randalls Rd, Leatherhead, Surrey KT22 7BA UK Tel: 01372 360 123 Fax: 01372 363 263 WWW: www.adbio.co.uk As of: Jan 2 1997 10:16AM AluI, BamHI, BcoI, BglI, BglII, BscBI, BscCI BscFI, BshI, BsiBI, BsiCI, BsiLI, BsiMI, BsiQI BsiXI, BsiYI, BsiZI, ClaI, EcoRI, EcoRV, HaeIII HindIII, HinfI, HpaI, KpnI, MboI, NciI, NcoI NotI, NruI, PstI, PvuII, RsaI, SacI, SacII SalI, SfiI, SmaI, SpeI, SphI, StuI, TaqI XbaI, XhoI

  10. New England BioLabs (REBASE abbr: N) 32 Tozer Rd., Beverly, MA 01915 USA Tel: 1-800-632-5227 Email: info@neb.com WWW: www.neb.com As of: May 20 1997 11:07AM AatII, Acc65I, AccI, AciI, AclI, AflII, AflIII AgeI, AhdI, AluI, AlwI, AlwNI, ApaI, ApaLI ApoI, AscI, AseI, AvaI, AvaII, AvrII, BamHI BanI, BanII, BbsI, BbvI, BcgI, BciVI, BclI BfaI, BglI, BglII, BlpI, BpmI, BsaAI, BsaBI BsaHI, BsaI, BsaJI, BsaWI, BseRI, BsgI, BsiEI BsiHKAI, BsiWI, BslI, BsmAI, BsmBI, BsmFI, BsmI BsoBI, Bsp120I, Bsp1286I, BspDI, BspEI, BspHI, BspMI BsrBI, BsrDI, BsrFI, BsrGI, BsrI, BssHII, BssKI BssSI, BstAPI, BstBI, BstEII, BstF5I, BstNI, BstUI BstXI, BstYI, BstZ17I, Bsu36I, Cac8I, ClaI, Csp6I DdeI, DpnI, DpnII, DraI, DraIII, DrdI, EaeI EagI, EarI, Ecl136II, Eco47III, Eco57I, EcoNI, EcoO109I EcoRI, EcoRV, EheI, Fnu4HI, FokI, FseI, FspI HaeII, HaeIII, HgaI, HhaI, HincII, HindIII, HinfI HinP1I, HpaI, HpaII, HphI, KasI, KpnI, MboI MboII, McrBC, MfeI, MluI, MnlI, MscI, MseI MslI, MspA1I, MspI, MwoI, NaeI, NarI, NciI NcoI, NdeI, NgoMI, NheI, NlaIII, NlaIV, NotI NruI, NsiI, PacI, PaeR7I, PflFI, PflMI, PleI PmeI, PmlI, Ppu10I, PpuMI, PshAI, Psp1406I, PstI PvuI, PvuII, RsaI, RsrII, SacI, SacII, SalI SapI, Sau3AI, Sau96I, SbfI, ScaI, ScrFI, SfaNI SfcI, SfiI, SmaI, SmlI, SnaBI, SpeI, SphI SspI, StuI, StyI, TaiI, TaqI, TfiI, TseI Tsp45I, Tsp509I, TspRI, Tth111I, XbaI, XcmI, XhoI XmaI, XmnI

  11. M.AluI, M.BamHI, M.ClaI, M.EcoDam, M.EcoRI, M.FnuDII, M.HaeIII M.HhaI, M.HpaII, M.MspI, M.PstI, M.SssI, M.TaqI I-CeuI, I-PpoI, PI-PspI, PI-SceI, PI-TliI Distributors for New England BioLabs: MIGLIORE LACLAUSTRA S.R.L. Av. Cordoba 1470 6o 12, 1055 Buenos Aires Argentina Tel: (1) 3729045 Fax: (1) 3729045 GENESEARCH PTY. LTD. 14 Technology Drive, Arundel, Queensland 4214 Australia Tel: (075) 94-0299 Fax: (075) 94-0562 Email: Genesearch@eworld.com BIOAGENCY Av. Anglica, 501-9o andar, So Paulo SP CEP 01227-000 Brazil Tel: (011) 66-3565,67-3993 Fax: (011) 825-2225

  12. enz_refs.txt REBASE version 003 gcgref.003 =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= REBASE, The Restriction Enzyme Database http://rebase.neb.com Copyright (c) Dr. Richard J. Roberts, 2000. All rights reserved. =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= Rich Roberts Mar 01 2000 References: 1. Abdurashitov, M.A., Belichenko, O.A., Degtyarev, S.K., Unpublished observ ations. 2. Abdurashitov, M.A., Belichenko, O.A., Lebedeva, N.A., Dedkov, V.S., Degty arev, S.K., Unpublished observations. 3. Abdurashitov, M.A., Belichenko, O.A., Lebedeva, N.A., Degtyarev, S.Kh., ( 1999) Biokhimiia, vol. 64, pp. 574-576. 4. Abdurashitov, M.A., Belichenko, O.A., Shevchenko, A.V., Dedkov, V.S., Deg tyarev, S.Kh., (1997) Nucleic Acids Res., vol. 25, pp. 2301-2302.

  13. enzyme.dat • Heading information • .. Divider • Enzyme data • One site per line • Comments follow ! on line

  14. Enzyme fields • Separated by at least one blank space

  15. Name • 1 - 31 characters • Names starting with a semicolon ; • Only used when specified • Not used when you answer * at the prompt • Isoschizomer of a more common enzyme

  16. Offset number • Where to mark the recognition site • Top strand cut point

  17. Recognition site • 5' - 3' • N term - C term • Proteases • 1 to 60 characters • Apostrophe ` • Cut site top strand • Underscore _ • Cut site bottom strand

  18. Overhang • Number of symbols from the cut point on the top strand where the bottom strand is cut

  19. REBASE version 003 gcgenz.003 =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= REBASE, The Restriction Enzyme Database http://rebase.neb.com Copyright (c) Dr. Richard J. Roberts, 2000. All rights reserved. =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= Rich Roberts Mar 01 2000 REBASE codes for commercial sources of enzymes A Amersham Pharmacia Biotech (11/98) B Life Technologies Inc. (1/98) C Minotech, Molecular Biology Products (3/99) D Angewandte Gentechnologie Systeme (10/97) E Stratagene (1/98) F Fermentas AB (8/99) G Appligene Oncor (10/97) H American Allied Biochemical, Inc. (10/98) I SibEnzyme Ltd. (9/99) J Nippon Gene Co., Ltd. (10/97)

  20. .. ;AatI 3 AGG'CCT 0 ! Eco147I,Pme55I,StuI,SseBI > O 1062 AatII 5 G_ACGT'C -4 ! > ADEFKLMNOPRS 1062,1239 ;AauI 1 T'GTAC_A 4 ! Bsp1407I,BsrGI,SspBI > I 978 AccI 2 GT'mk_AC 2 ! > ABDEGJKLMNOPQRS 470,472,611,1260 ;AccII 2 CG'CG 0 ! BstUI,MvnI,ThaI,Bsh1236I > AJKQ 501,1260 ;AccIII 1 T'CCGG_A 4 ! BseAI,BsiMI,Bsp13I,BspEI,Kpn2I,MroI > EJKQR 502,739 ;Acc16I 3 TGC'GCA 0 ! AviII,FspI,NsbI > DI 213 ;Acc65I 1 G'GTAC_C 4 ! Asp718I,KpnI > DFINR 828 ;Acc113I 3 AGT'ACT 0 ! Eco255I,ScaI > I 211 ;AccB1I 1 G'GyrC_C 4 ! BanI,Eco64I,BshNI > I 213 ;AccB7I 7 CCAn_nnn'nTGG -3 ! PflMI,Van91I,Esp1396I > IR 209 ;AccBSI 3 CCG'CTC 0 ! BsrBI > DI 737

  21. Translation Map(and many other programs)

  22. Translation Tables • Heading information precedes .. divider • One amino acid per line • Each field is separated by one or more spaces

  23. Fields • Single letter symbol • Three letter symbol • Listing of all unambiguous codons • Separate by a space • Exclamation point ! • Listing of ambiguous codons

  24. Start and Stop Codons • Start codons • List as lower case letters • All other codons are upper case • Stop Codons • * - single letter • end - three letter

  25. Standard Translation Table Symbol 3-letter Codons ! IUPAC .. A Ala GCT GCC GCA GCG ! GCX B Asx ! RAY C Cys TGT TGC ! TGY D Asp GAT GAC ! GAY E Glu GAA GAG ! GAR F Phe TTT TTC ! TTY G Gly GGT GGC GGA GGG ! GGX H His CAT CAC ! CAY I Ile ATT ATC ATA ! ATH J ??? ... ! ... K Lys AAA AAG ! AAR L Leu TTG TTA CTT CTC CTA CTG ! TTR CTX YTR ; YTX M Met atg ! ATG N Asn AAT AAC ! AAY

  26. O ??? ... ! ... P Pro CCT CCC CCA CCG ! CCX Q Gln CAA CAG ! CAR R Arg CGT CGC CGA CGG AGA AGG ! CGX AGR MGR ; MGX S Ser TCT TCC TCA TCG AGT AGC ! TCX AGY ; WSX T Thr ACT ACC ACA ACG ! ACX U ??? ... ! ... V Val GTT GTC GTA GTG ! GTX W Trp TGG ! TGG X Xxx ! XXX Y Tyr TAT TAC ! TAY Z Glx ! SAR . ... ... ! ... * End TAA TAG TGA ! TAR TRA ; TRR

  27. Alternate Translation Tables • Modified from those used at NCBI • Located in GenMoreData • transl_table_01.txt

  28. Alternate Translation Tables • 1 - Standard Code • 2 - Vertebrate Mitochondrial • 3 - Yeast Mitochrondrial • 4 - Mold, Protozoan, and Coelenterate Mitochondrial and the Mycoplasma/Spiroplasma • 5 - Invertebrate Mitochondrial • 6 - Ciliate, Dasycladacean and Hexamita nuclear • 9 - Echinoderm (starfish and sea urchin) Mitochondrial

  29. Alternate Translation Tables • 10 - Euplotid Nuclear • 11 - Bacterial Code • Alternative Initiation Codons GUG, UUG, AUU, CUG • 12 - Alternative Yeast Nuclear • 13 - Ascidian Mitochondrial • 14 - Flatworm Mitochondrial • 15 - Blepharisma Mitochondrial • 16 - Chlorophycean Mitochondrial • 21 - Chlorophycean Mitochondrial

  30. !!GENETIC_CODE 1.0 transl_table = 4 This file contains the Mold, Protozoan, and Coelenterate Mitochondrial and the Mycoplasma/Spiroplasma Code translation table, specified in the Feature Definition, Version 1.08, formatted for use with GCG programs. It names amino acids in both one and three-letter form and lists the codons which should translate into them. All GCG translation programs may generate their translations from the unambiguous codons in this table. Codons which are all lower case are start codons. Alternative Initiation Codons: Trypanosoma: UUA, UUG, CUG Leishmania: AUU, AUA Tertrahymena: AUU, AUA, AUG Paramecium: AUU, AUA, AUG, AUC, GUG, GUA(?) (Pritchard et al., 1990)

  31. Systematic Range: Mycoplasmatales: Mycoplasma, Spiroplasma (Bove et al., 1989); Fungi: Emericella nidulans, Neurospora crassa, Podospora anserina, Acremonium (Fox, 1987), Candida parapsilosis (Guelin et al., 1991), Trichophyton rubrum (de Bievre and Dujon, 1992), Dekkera/Brettanomyces, Eeniella (Hoeben et al.,1993), and probably Ascobolus immersus, Aspergillus amstelodami, Claviceps purpurea, and Cochliobolus heterostrophus. Protozoa: Trypanosoma brucei, Leishmania tarentolae, Paramecium tetraurelia, Tetrahymena pyriformis and probably Plasmodium gallinaceum (Aldritt et al., 1989)]. Metazoa: Coelenterata (Ctenophora and Cnidaria)

  32. Comments: * This code is also used for the kinetoplast DNA (maxicircles, minicircles). Kinetoplasts are modified mitochondria (or their parts). * This code is not used in the Acholeplasmataceae and plant-pathogenic mycoplasma-like organisms (MLO) (Lim and Sears, 1992) This code differs from the standard code in the following codons: Mitochondrion Standard W Trp TGA * End TGA The Mold, Protozoan, and Coelenterate Mitochondrial and Mycoplasma/Spiroplasma Code

  33. Symbol 3-letter Codons ! IUPAC .. A Ala GCT GCC GCA GCG ! GCX B Asx ! RAY C Cys TGT TGC ! TGY D Asp GAT GAC ! GAY E Glu GAA GAG ! GAR F Phe TTT TTC ! TTY G Gly GGT GGC GGA GGG ! GGX H His CAT CAC ! CAY I Ile att atc ata ! ATH J ??? ... ! ... K Lys AAA AAG ! AAR L Leu tta ttg CTT CTC CTA ctg ! TTR CTX YTR M Met atg ! ATG N Asn AAT AAC ! AAY O ??? ... ! ... P Pro CCT CCC CCA CCG ! CCX Q Gln CAA CAG ! CAR R Arg CGT CGC CGA CGG AGA AGG ! CGX AGR MGR S Ser TCT TCC TCA TCG AGT AGC ! TCX AGY T Thr ACT ACC ACA ACG ! ACX U ??? ... ! ... V Val GTT GTC GTA gtg ! GTX W Trp TGG TGA ! TGR X Xxx ! XXX Y Tyr TAT TAC ! TAY Z Glx ! SAR . ... ... ! ... * End TAA TAG ! TAR

  34. Map • Sequence listing • Restriction Sites listed above the sequence • Amino acid translation below the sequence

  35. analyze% map -check ge:humcftrm Map maps a DNA sequence and displays both strands of the mapped sequence with restriction enzyme cut points above the sequence and protein translations below. Map can also create a peptide map of an amino acid sequence. Minimal Syntax: % map [-INfile=]gamma.seq -Default Prompted Parameters: -BEGin=2161 -END=2600 range of sequence in which to look for sites -ENZymes=*[,...] chooses the enzymes used in the search -MENu=s translation frames s=six, t=three, o=open [-OUTfile=]gamma.map output file name Local Data Files: -DATa=enzyme.dat restriction enzyme names and recognition sites -DATa=proenzyme.dat peptidases and peptide cleavage reagents -TRANSlate=translate.txt the genetic code TRANSlate=15 (number of translation table)

  36. Optional Parameters: -WIDth=100 sets display width to something other than 60 bp-line -PAGe[=62] adds form-feeds to keep clusters on a single page -OPEn[=20] translates only in open reading frames [minimum ORF length] -ONCe shows only enzymes that cut once -MINCuts=2 shows only enzymes that cut at least 2 times -MAXCuts=2 shows only enzymes that cut no more than 2 times -EXCLude=n1,n2 doesn't show enzymes that cut between bases n1 and n2 -ALL finds "overlapping-set" matches -PERFect finds only perfect symbol matches between site and sequence -CIRcular treats the sequence as circular -LINear treats the sequence as linear (default) -APPend appends enzyme data file to your output -THReeletter uses three-letter amino acid codes to show translation -SILent finds translationally silent potential restriction sites

  37. -MISmatch=1 finds restriction sites with one or fewer mismatches -NOSEQline suppresses the sequence display -NOSCALeline suppresses the scale line -NOCOMPline suppresses the complement sequence display -NOCUTline suppresses line of '|' characters showing cut points -MINSitelen=6 selects enzymes with 6 (or more) bases in recognition site -OVErhang=0 selects only blunt-end cutters ("5" for 5', "3" for 3') -VERtical displays enzyme names vertically over cut points -BOTtom shows both forward and reverse strand cut points -CUTters[=fn] writes enzyme data file with enzymes that did cut -NONCUTters[=fn] writes enzyme data file with enzymes that did not cut -EXCUTters[=fn] writes enzyme data file with enzymes that were excluded -TABle shows the map as a list of cut positions, sorted by position -SORtbyenzyme sorts table output first by enzyme, then by cut position -NOMONitor suppresses the screen monitor -NOSUMmary suppresses the screen summary Add what to the command line ? -once

  38. Begin (* 1 *) ? End (* 6129 *) ? Select the enzymes: Type nothing or "*" to get all enzymes. Type "?" for help on which enzymes are available and how to select them. Enzyme(* * *): ? Select enzymes: Type "*" to select all enzymes. Type "**" to select all enzymes including isoschizomers. Type individual names like "AluI" to select specific enzymes. Type "?" to see this message and all available enzymes. Type "??" to see the available enzymes AND their recognition sites. Type "?A*" to see what enzymes start with "A." Type "A*" to select all enzymes starting with "A." Type parts of names like "Al*" to select all enzymes starting with "AL." Type "~A*" to unselect all selected enzymes starting with "A." Type "/*" to see what enzymes you have selected so far. Type " " to select no enzymes at all. Press <Return> after each selection. Press <Return> and nothing else to end your selections. Spaces are allowed; upper and lower case are equivalent.

  39. AatI AatII AauI AccI AccII AccIII Acc16I Acc65I Acc113I AccB1I AccB7I AccBSI AceIII AciI AclI AclNI AclWI AcsI AcyI AfaI AfeI AflII AflIII AgeI AhaIII AhdI AluI AlwI Alw21I Alw26I Alw44I AlwNI Ama87I AocI Aor51HI ApaI ApaBI ApaLI ApoI AscI AseI AsiAI AsnI AspI Asp700I Asp718I AspEI AspHI AspLEI AspS9I AsuI AsuII AsuC2I AsuHPI AsuNHI AvaI AvaII AvaIII AviII AvrII AxyI BaeI BaeI BalI BamHI BanI BanII BanIII BbeI BbiII BbrPI BbsI BbuI BbvI BbvII Bbv12I BccI Bce83I BcefI BcgI BcgI BciVI BclI BcnI BcoI BetI BfaI BfiI BfmI BfrI BglI BglII BinI BlnI BlpI Bme18I BmgI BmyI BpiI BplI BpmI Bpu10I Bpu14I Bpu1102I BpuAI BsaI Bsa29I BsaAI BsaBI BsaHI BsaJI BsaMI BsaOI BsaWI BsaXI BsbI BscI Bsc4I BscBI BscCI BscFI BscGI Bse1I Bse8I Bse21I Bse118I Bse3DI BseAI BseCI BseDI BseGI BseLI BseMII

  40. What protein translations do you want: a) frame 1 b) frame 2 c) frame 3 d) frame 4 e) frame 5 f) frame 6 t)hree forward frames s)ix frames o)pen frames only n)o protein translation q)uit Please select (capitalize for 3-letter) (* t *): What should I call the output file (* humcftrm.map *) ? Mapping ......................... Writing .......... .. MAP complete with: Sequence Length: 6,129 Enzymes Chosen: 217 Cutsites found: 1,162 CPU time: 04.17 Output file(s): humcftrm.map

  41. (Linear) MAP of: gb_pr1:humcftrm check: 6781 from: 1 to: 6129 LOCUS HUMCFTRM 6129 bp mRNA PRI 15-DEC-1989 DEFINITION Human cystic fibrosis mRNA, encoding a presumed transmembrane conductance regulator (CFTR). ACCESSION M28668 NID g180331 KEYWORDS cystic fibrosis; transmembrane conductance regulator. . . . With 217 enzymes: * MaxCuts: 1 April 22, 1998 18:07 ..

  42. BsrBI | AATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCA 1 ---------+---------+---------+---------+---------+---------+ 60 TTAACCTTCGTTTACTGTAGTGTCGTCCAGTCTCTTTTTCCCAACTCGCCGTCCGTGGGT a N W K Q M T S Q Q V R E K G L S G R H P - b I G S K * H H S R S E K K G * A A G T Q - c L E A N D I T A G Q R K R V E R Q A P R - 1 ---------+---------+---------+---------+---------+---------+ 60 d I P L L H C * L L D S F F P Q A A P V W - e Q F C I V D C C T L S F P N L P L C G - f N S A F S M V A P * L F L T S R C A G - EcoO109I Psp5II SanDI | GAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGC 61 ---------+---------+---------+---------+---------+---------+ 120 CTCATCATCCAGAAACCGTAATCCTCGAACTCGGGTCTGCCGGGATCGTCCCTGGGGTCG a E * * V F G I R S L S P D G P S R D P S - b S S R S L A L G A * A Q T A L A G T P A - c V V G L W H * E L E P R R P * Q G P Q R - 61 ---------+---------+---------+---------+---------+---------+ 120 d L L L D K A N P A Q A W V A R A P V G A - e S Y Y T K P M L L K L G S P G L L S G L - f L T T P R Q C * S S S G L R G * C P G W -

  43. Enzymes that do cut and were not excluded: AvaI AvrII BaeI BcgI BmgI Bpu10I BsaHI BsaXI BspEI BsrBI BsrGI BstXI BstZ17I ClaI EcoO109I FspI HpaI KpnI NciI NruI PmlI Psp5II SanDI SpeI SphI ThaI Tth111I UbaEI XbaI Enzymes that do not cut: AatII AhdI ApaI ApaLI AscI BsaBI BscGI BsiEI BsmBI BspLU11I BsrFI BssHII BstAPI BstEII DrdI EagI EciI Eco47III EcoRV FauI FseI GdiII HgiEII MluI MunI NarI NdeI NgoAIV NheI NotI NsiI NspV PacI Pfl1108I PinAI PmeI PshAI Psp1406I PstI PvuI RsrII SacII SalI SapI SbfI SexAI SfiI SgfI SgrAI SmaI SmiI SnaBI SrfI Sse8647I StuI SunI TaqII UbaDI XhoI Enzymes excluded; MinCuts: 1 MaxCuts: 1 AccI AceIII AciI AflII AflIII AluI AlwI AlwNI ApoI AvaII BaeI BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BciVI BclI BfaI BfiI BglI BglII BplI BpmI Bpu1102I BsaI BsaAI BsaJI BsaWI BsbI BseMII BseRI BsgI BsiHKAI BslI BsmI BsmAI BsmFI Bsp24I Bsp24I Bsp1286I BspGI BspMI BsrI BsrDI BssSI Bst4CI BstDSI BstYI Bsu36I Cac8I CjeI CjeI CjePI CjePI CviJI CviRI DdeI DpnI DraI DraIII DrdII EaeI EarI Eco57I EcoNI EcoRI EcoRII Fnu4HI FokI HaeI HaeII HaeIII HgaI HhaI Hin4I HincII HindIII HinfI HphI MaeIII MboII MmeI MnlI MscI MseI MslI MspI MspA1I MwoI NcoI NlaIII NlaIV NspI PflMI PleI PvuII RcaI RleAI RsaI SacI Sau96I Sau3AI ScaI ScrFI SfaNI SfcI SimI SmlI SspI StyI TaiI TaqI TaqII TatI TauI TfiI TseI Tsp45I Tsp509I TspRI Tth111II VspI XcmI XmnI

  44. MapSort • Enzymes listed alphabetically • Display cut positions for each enzyme • Fragments arranged by size • Shows products of multiple digests

  45. analyze% mapsort -check ge:humcftrm MapSort finds the coordinates of the restriction enzyme cuts in a DNA sequence and sorts the fragments of the resulting digest by size. MapSort can sort the fragments from single or multiple enzyme digests. Minimal Syntax: % mapsort [-INfile=]GenBank:SynpBR322 -Default Prompted Parameters: -BEGin=1 -END=4361 range of interest -CIRcular treats chosen range as circular -ENZymes=*,[.,.,.] enzymes to be mapped -OUTfile=synpbr322.mapsort output file name Local Data Files: -DATa=enzyme.dat restriction enzyme names and recognition sites -DATa=proenzyme.dat peptidases and peptide cleavage reagents -TRANSlate=translate.txt contains the genetic code

  46. Optional Parameters: -ONCe shows enzymes that cut only once -MINCuts=2 shows only enzymes that cut at least 2 times -MAXCuts=2 shows only enzymes that cut no more than 2 times -EXCLude=n1,n2 suppresses enzymes that cut between bases n1 and n2 -DIGest sort the cuts for all the enzymes together in one digest -LINear treats chosen range as linear (default) -ALL does an "overlapping-set" map -PERFect looks only for perfect matches -NOSIZe suppresses the report of fragment sizes in your output -MISmatch=1 finds potential sites with one or fewer mismatches. -SILent finds translationally silent potential restriction sites -PLAsmid makes output suitable for display by PLASMIDMAP -FRAGments puts "blocks" not "ticks" into the PLASMIDMAP label file -APPend appends enzyme file and translation table to your output -CUTters[=fn] writes enzyme data file with enzymes that did cut -NONCUTters[=fn] writes enzyme data file with enzymes that did not cut -EXCUTters[=fn] writes enzyme data file with enzymes that were excluded -MINSitelen=6 selects enzymes with 6 (or more) bases in recognition site -OVErhang=0 selects only blunt-end cutters ("5" for 5', "3" for 3') Add what to the command line ? -once

  47. Begin (* 1 *) ? End (* 6129 *) ? Is this sequence circular (* No *) ? Select the enzymes: Type nothing or "*" to get all enzymes. Type "?" for help on which enzymes are available and how to select them. Enzyme(* * *): What should I call the output file (* humcftrm.mapsort *) ? Mapping ...... analyze%

  48. (Linear) MAPSORT of: gb_pr1:humcftrm Check: 6781 from: 1 to: 6129 With 217 enzymes: * MaxCuts: 1 April 22, 1998 18:09 .. AvaI C'yCGr_G Cuts at: 0 122 6129 Size: 122 6007 AvrII C'CTAG_G Cuts at: 0 5863 6129 Size: 5863 266 BaeI ACnnnnGTAyCnnnnnnn_nnnnn' Cuts at: 0 1433 6129 Size: 1433 4696

  49. (Linear) (Silent) MAPSORT of: gb_pr1:humcftrm With 217 enzymes: * MaxCuts: 1 April 22, 1998 18:11 .. AscI GG'CGCG_CC Cuts at: 0 2419* 6129 Size: 2419 3710 FseI GG_CCGG'CC Cuts at: 0 848* 6129 Size: 848 5281 PmeI GTTT'AAAC Cuts at: 0 2193* 6129 Size: 2193 3936 Note: The range you define must specify a coding region and reading frame precisely

  50. (Linear) MAPSORT of: synpgem3v.gb_sy With 2 enzymes: ECORI AATII April 22, 1998 18:14 .. AatII G_ACGT'C Cuts at: 0 2095 2867 Size: 2095 772 EcoRI G'AATT_C Cuts at: 0 58 2867 Size: 58 2809

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer