aiko-hull
Uploaded by
61 SLIDES
1100 VUES
630LIKES

Section H – Cloning vectors

DESCRIPTION

Section H – Cloning vectors. Contents. H1 Design of plasmid vectors Ligation products , Twin antibiotic resistance , Blue-white screening , Multiple cloning sites , Transcription of cloned inserts , Expression vectors H2 Bacteriophage vectors

1 / 61

Télécharger la présentation

Section H – Cloning vectors

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Section H – Cloning vectors

  2. Contents H1 Design of plasmid vectors Ligation products, Twin antibiotic resistance, Blue-white screening, Multiple cloning sites, Transcription of cloned inserts, Expression vectors H2 Bacteriophage vectors Bacteriophage λ, λReplacement vectors, Packaging and infection, Formation of plaques, λLysogens, M13 phage vectors, Cloning in M13, Hybrid plasmid-M13 vectors H3 Cosmids, YACs and BACs Cloning large DNA fragments, Cosmid vectors, YAC vectors, Selection in S. cerevisiae, BAC vectors H4 Eukaryotic vectors Cloning in eukaryotes, Transfection of eukaryotic cells, Shuttle vectors, Yeast episomal plasmids, Agrobacterium tumefaciens TI plasmid, Baculovirus, Mammalian viral vectors, Direst gene transfer

  3. H1 Design of plasmid vectors — Ligation products • The most frequent unwanted product is recreated vector plasmid formed by circularization of the linear vector fragment

  4. Minipreparations from a number of transformed colonies, and screening by digestion and agarose gel electrophoresis.

  5. H1 Design of plasmid vectors — Twin antibiotic resistance Contain two antibiotic resistance genes: If a target DNA fragment is ligated into the coding region of one of the resistance genes the gene will become insertionally inactivated, and can be determined by the antibiotic resistance exhibited by the transformants.

  6. Ampr Tcr B pBR322 B X B ori B Ampr Ampr Tcr X Recombinant Religated B ori ori Ampicillin resistant? yesyes Tetracycline resistant?No yes Screening by insertional inactivation of a resistance gene

  7. Replica plating: transfer of the colonies from one plate to another using absorbent pad or velvet transfer of colonies +ampicillin + ampicillin + tetracycline These colonies have bacteria with recombinant plasmid

  8. H1 Design of plasmid vectors — Blue-white screening • A more sophisticated procedure can be carried out on a single transformation plate; • Blue white screening; • Involves the insertional inavtivation of the gene lacZ.

  9. Screening by insertional inactivation of the lacZ gene Lac promoter MCS(Multiple cloning sites) Ampr pUC18 (3 kb) lacZ’ ori The insertion of a DNA fragment interrupts the ORF of lacZ’ gene, resulting in non-functional gene product that can not digest its substrate x-gal.

  10. lacZencode enzyme b-galactosidase lac promoter (substrate of the enzyme) X-gal RegulatoryGene Operon IPTG Blue product DNA i p o z y a m-RNA Protein β-Galactosidase Transacetylase Permease

  11. Recreated vector: blue transformants Recombinant plasmid: white transformants (containing inserted DNA) Recreated vector (no insert) Recombinant plasmid (contain insert)

  12. lacZ’: a shortened derivative of lacZ, encoding N-terminal a-peptide of b-galactosidase. Host strain carrying a mutant gene encoding only the C-terminal portion of -galactosidase which can then complement the a-peptide to produce the active enzyme

  13. Lac promoter MCS Ampr Insertion of target DNA in MCS inactivates the lacZ’ pUC18 (3 kb) lacZ’ ori SalI HincII AccI SmaI XmaI BamHI EcoRI SacI KpnI XbaI PstI SphI …ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA… . Thr Asn Ser Ser Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser… Lac Z’ H1 Design of plasmid vectors — Multiple cloning sites Multiple restriction sites enable the convenient insertion of target DNA into a vector

  14. H1 Design of plasmid vectors — Transcription of cloned inserts Some cloning vector :The pUC vectors have a promoter(lac) adjacent to the site of insertion of a cloned fragment, such a promoter could be used to transcribe the inserted DNA, either to produce an RNA transcript in vitro (used as a hybridization probe), or to express the protein product of a gene. Special transcriptional vectors • The pBluescript ⅡSK has promoters from bacteriophages T7 and SP6 flanking an MCS.

  15. H1 Design of plasmid vectors — Expression vectors • (1)Promoter and terminator for RNA transcription are required. • (2)Intact ORF and ribosomal binding sites are required for translation.

  16. Strong Promoters • Promoter: • lacUV-5: a strong mutant lac promoter independent of cAMP receptor protein (CRP or CAP) . • lPL promoter • Phage T7 promoter • Fusion protein and fusion tag • Defined epitope : a small piece of peptide sequence containing a defined epitopeor specific binding site • Green fluorescent protein : fusion withGFP. • His-tag: usually 6 consecutive histidines, which allows purification of the fusion protein by binding to Ni 2+ column. Commonly used in E. coli.

  17. Lac promoter MCS Ampr pUC18 (3 kb) lacZ’ ori SalI HincII AccI SmaI XmaI BamHI EcoRI SacI KpnI XbaI PstI SphI …ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA… . T h rA s n S er S e r Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser… Lac Z’ • The ORF of the inserted gene has to be in the same direction and same frame as the lacZ’ • A fusion protein between the N-terminal sequence of lacZ and the inserted ORF produced

  18. SmaI XmaI SalI HincII AccI SacI BamHI SphI HindⅢ EcoRI KpnI XbaI PstI ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT M I T N S S S V P G D P L E S T C R H A S L ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCgatgcggagc..gtgaacggatagCTGCAG M I T N S S S V P G D P M R S ..V N G * Inserted ORF From original ORF Add one nucleotide (g) between BamHI site (GGATCC) and the first codon (ATG) to fuse the two ORFs BamHI: GGATCC PstI: CTGCAG CCTAGG GACGTC The following fusion is wrong: ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCatgcggagc..gtgaacggatagCTGCAG M I T N S S S V P G D P C G G .. * How to make a fusion protein (in pUC18)?

  19. H2 Bacteriophage vectors — Bacteriophage λ 1.Viruses that can infect bacteria. 2.48.5 kb in length 3.Lytic phase:Replicate and release 4.Lysogenic phase:integrate into host genome

  20. 5.The phage  cos ends (Linear or circular genome) 5‘-CGGGGCGGCGACCTCG-3’ 3’-GCCCCGCCGCTGGAGC-5’ Cleavage Ligation (during packaging) (after infection) GGGCGGGCGACCTCG-3’ 5’-CG + GC-5’ 3’-GCCCCGCCGCTGGA Circular form Linear form

  21. H2 Bacteriophage vectors — λReplacement vectors • e.g. EMBL3, DASH • Replace the nonessential region of the phage genome with exogenous DNA (~20kb)

  22. H2 Bacteriophage vectors — Packaging and infection • Replication of phage λin vivo produces long linear molecules with multiple copies of the λ genome. These concatemers are then cleaved at the cos sites, to yield individual λ genomes, which are then packaged into the phage particles. • Ligated λ ends which do not contain an insert, or have one which is smaller or larger than the 20kb optimum, are too small or to large to be packaged, and recombinants with two left or right arms are likewise not viable. • High infection efficiency (109 recombinants/ug vector DNA, 100-time higher than plasmid)

  23. H2 Bacteriophage vectors — Formation of plaques • The clear areas within the lawn where lysis and re-infection have prevented the cells from growing. • Recombinant l DNA may be purified from phage particles from plaques or from liquid culture.

  24. H2 Bacteriophage vectors — λLysogens • Genes or foreign sequences may be incorporated essentially permanently into the genome of E. coli by integration of a  vector containing the sequence of interest.

  25. The E. coli strain BL21(DE3) include the gene for T7 RNA polymerase under control of the lac promoter as a  lysogen. The gene can be induced by IPTG, and the polymerase will then transcribe the gene in the expression vector.

  26. H2 Bacteriophage vectors — M13 phage vectors • E. coli vector; • 6.7 kb circular single strand of DNA; • Contrasting to phage ,the cell are not lysed by M13, but continue to grow slowly,and single-stranded forms are continuously packaged and released from the cells as new phage particles.

  27. Cloning  Transfection  Growth  Plaques formation RF recombinant plating on slow like plasmidDNA a cell lawn growth H2 Bacteriophage vectors — Cloning in M13 • When the single-stranded form of a fragment is required fragments are subcloned into M13 RF using standard plasmid methods.

  28. H2 Bacteriophage vectors — Hybrid plasmid-M13 vectors • Small plasmid vectors being developed to incorporate M13 functionality. • Contain both the plasmid and M13 origins of replication. • Normally propagate as true plasmids. • Can be induced to form single-stranded phage particles by infection of the host cell with a helper phage.

  29. H3 Cosmids, YACs and BACs — Cloning large DNA fragments • Analysis of eukaryotic genes and the genome organization of eukaryotes requires vectors with a larger capacity for cloned DNA than plasmids or phage  • Human genome (3 x 109 bp): large genome and large gene demand vectors with a large size capacity.

  30. The limitation of conventional gel electrophoresis: large DNA fragments do not separate, but instead, comigrate, because nucleic acids alternate between globular and linear forms. • If the field is applied discontinuously and the direction is also made to vary,the DNA molecules reorient their long axes and takes longer for larger molecules.

  31. H3 Cosmids, YACs and BACs — Cosmid vectors • Utilizing the properties of the phage l cos sites in a plasmid vector. • The insert can be 30-45 kb

  32. The simplest cosmid vector A normal small plasmid, containing a plasmid origin of replication, a selectable marker, a cos site, a suitable restriction site for cloning.

  33. Cloning in a cosmid vector C2XB

  34. H3 Cosmids, YACs and BACs — YAC vectors Essential components of YAC vectors : • Centromere • Telomere • Autonomous replicating sequence • Ampr for selective amplification and markers

  35. YACs can accommodate genomic DNA fragments of more than 1 Mb, and can be used to clone the entire human genes, but not good in mapping and analysis. YACs have been invaluable in mapping the large-scale structure of large genomes, for example in the Human Genome Project.

  36. H3 Cosmids, YACs and BACs — Selection in S. cerevisiae • (1)Growth of yeast on selective media lacking specific nutrients can serve for selection. Auxotrophic yeast mutants are made as host strains for plasmids containing the genes complementary to the growth defect. • (2)Saccharomyces cerevisiae selectable markers do not confer resistance to toxic substances

  37. H3 Cosmids, YACs and BACs — BAC vectors BAC:Bacterial Artificial Chromosome, 300kb Vectors for large DNA fragments BAC: 300kb PAC: Bacteriophage P1 cloning system,100kb Cosmid:35-45 kb YAC: > 1Mb (1987)

  38. H4 Eukaryotic vectors — Cloning in eukaryotes • Many applications of genetic engineering require vectors for the expression of genes in diverse eukaryotic species.

  39. H4 Eukaryotic vectors — Transfection of eukaryotic cells The take-up of DNA into eukaryotic cells • More problematic than bacterial transformation. The plant cell wall must normally be digested to yield fragile protoplasts, which may then take up DNA fairly readily. • Much lower efficiency

  40. Transfection methods: • Calcium phosphate • Electroporation • Gene gun • Microinjection

  41. H4 Eukaryotic vectors — Shuttle vectors • Most of the eukaryotic vectors are constructed as shuttle vectors . • Vectors contain sequences required for replication and selection in both E. coli and the desired host cells, so that the construction and many other manipulation of the vectors can be completed in E. coli., before transfer to the appropriate eukaryotic cells.

  42. A Shuttle vector MCS

  43. H4 Eukaryotic vectors — Yeast episomal plasmids Vectors for the cloning and expression of genes in Saccharomyces cerevisiae. • Based on 2 micron (2m) plasmid which is 6 kb in length. • One origin • Two genes involved in replication • A site-specific recombination protein FLP, homologous to  Int. 2. Normally replicate as plasmids, and may integrate into the yeast genome.

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer