Decoding DNA: Transcription & Translation Explained Clearly
Explore the fascinating processes of DNA transcription and translation, converting genetic information into functional proteins. Witness the magic of amino acids and understand the intricate language of nucleotides to amino acid strings. Discover the roles of RNA polymerase, ribosomes, and tRNAs in protein synthesis. Unravel the secrets of genetic codes and the significance of mutations in protein formation. This comprehensive guide to molecular biology will deepen your understanding of life's building blocks.
Decoding DNA: Transcription & Translation Explained Clearly
E N D
Presentation Transcript
How? Why? Transcription: Writing again Translation: Changinglanguages
Today we’ll go from here... To here We can do anything Text
Off to see the wizard... Sending ‘messages’ out from DNA • DNA replication • both strands => new DNA • => new cell • Transcription • 1 strand => new RNA • => new protein
Transcription: seeing it http://www.hhmi.org/biointeractive/media/DNAi_transcription_vo1-lg.mov
Amino acids • From 4 letters of storage/information • to • 20 letters of action!!
20 toys • EVERY one has a blue part. Chem name? • EVERY one has a red part. Chem name? • Thus these are all...? • How many are there?
aaDancer • Why do nucleotides look like nucleotides, while amino acids look like amino acids? • Remember the handshakes • What are amino acids ‘for’?
Different tools; different jobs • You & partner have an amino acid; which is it? (StructViewer or homepage => left column ‘big twenty’ amino acids) • In what ways are all bases identical? Different? • In what ways are all amino acids identical? Different? • Which set is more diverse in terms of ‘feel’? • Which more diverse in terms of shape? • Which would allow you to build more diverse shapes & surfaces?
Mutation--not always bad • While the comparison is often made, proteins are not sentences • An amino acid is a collection of properties; changing from one to another changes a region of the protein by (little/some/a lot/completely) • It’s an exaggeration, but think of amino acids more like different vacuum cleaner nozzles
Walking the walk • How bio machines translate the language of nucleotides into an amino acid string
Biology: because it has to work like that way • Von Neumann argued that... [self-reproducing] machines would need to store separately the information needed to make the machine and would need to have a mechanism to interpret that information—a tape and a tape reader. In effect, he abstractly described the gene, the ribosome, and the messenger. --Matt Ridley in Francis Crick, discoverer of the genetic code
Types of bonds • VELCRO: a bond that can be cheerfully broken/re-made during lab • Duct tape: same at the molecular level, but at the 181L student level, breaking such a bond gets you a zero on this week’s quiz
Blinding you with Science (jargon) • RNA Polymerase: joins RNA links into a chain • mRNA: messenger RNA; RNA string copied (‘transcribed’) from DNA • tRNA: transfer RNA; one of many RNA molecules that carry specific amino acids • ribosome: giant machine (>200 proteins, 4 RNAs (2 > 1000 nucleotides) that oversees the reading of the mRNA and the creation of polypeptide • aminoacyl tRNA synthetase: protein machine adds amino acid to tRNAs • Termination factor: ‘reads’ UAA etc., => ribosome looses the peptide & falls apart
Roles--for single mRNA 5’ end is pointy/spiky 3’ end is soft/furry • 4 tRNA (1-2 people) • 4 pairs to be synthetases • 1 small ribosomal subunit x 2 • 1 large ribosomal subunit x 2 • 2 to be (RNA polymerase & the RNA it makes ) • 1 termination factor (1-2 people)
Roles--for TWO mRNA 5’ end is pointy/spiky 3’ end is soft/furry • 4 tRNA • 4 synthetases • 1 ribosome • 1-2 to be (RNA polymerase & the RNA it makes ) • 1 termination factor
Learning your ‘lines’ • Handout: Each group find questions related to their role; answer them • Lab manual, textbook, internet OK as sources • Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts 5’ end is pointy/spiky 3’ end is soft/furry
DNA template strand 5’ CTTAAATCCGAATGCCCATG 3’
DNA template strand(alternate version) 5’ CTTAAATCCGAATGCCCATG 3’ 5’ end is pointy/spiky 3’ end is soft/furry
Special powers • Recall that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit • Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!
Choreographing translation • A play of many parts, many players, no brains
Going with the flow • mRNA at the central bench • ribosome assembles around it • synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA) • tRNAs will ‘diffuse’ by following a path through the room • When any event first happens*, action stops, molecules involved will announce, explain • Go until a protein happens *This includes non-events (rejections, etc.)
Walk-through with 1 tRNA • Everybody watches visits to synthetase, ribosome • In the real world, everything is happening all the time; all is happenstance
Who knows the code? • What happens if a tRNA carries the wrong amino acid? • What happens if the mRNA contains a copy error relative to DNA? • What happens if a tRNA has a mutated anticodon
Review movie • (in TA desktop folder)
Exit Condition • 1.) Pair up (two in a group) • 2.) Write your names and SECTION at the top of the paper • 3.) EXPLAIN the process of TRANSLATION • Include the following in your answer: • tRNA • mRNA • ribosome • UAG codon • RNA Polymerase • aminoacyl tRNA synthetase • termination factor • diffusion From Emily
Homework • StructViewer*--amino acid look & feel** • Begin thinking about your project • Assessor: mutation & translation • *As will always be the case in this course, no tricks; focus on the primary idea(s) • **‘SurfaceViewer’ link from Software page may help • ...Ch. 3 reading about the immune system is just for fun
It Has to Be part II "The main idea was that it was very difficult to consider how DNA or RNA, in any conceivable form, could provide a direct template for the side-chains of the twenty standard amino acids. What any structure was likely to have was a specific pattern of atomic groups that could form hydrogen bonds. I therefore proposed a theory in which there were twenty adaptors (one for each amino acid), together with twenty special enzymes. Each enzyme would join one particular amino acid to its own special adaptor. This combination would then diffuse to the RNA template. An adaptor molecule could fit in only those places on the nucleic acid template where it could form the necessary hydrogen bonds to hold it in place. Sitting there, it would have carried its amino acid to just the right place where it was needed." From “What mad pursuit”, Francis Crick’s memoir of his days in the molecular world
Tools of the times • while real ribosomes require specific ‘instruction’ and ‘landing pad’, they could be fooled into starting randomly • biochemists had found an enzyme that would take a pot full of ribonucleotides and polymerize* them willy-nilly (in random sequence) *poly: multiple mer: unit i.e., to form multiples from single units
Experiments & interpretations • Starting simple. If the only nucleotide you add to the mix is rCTP, what RNA chain will you make? • You add cell extracts that can do translation. You find some protein made, and it consists only of prolines strung together. What do you conclude? • You decide to look into C + A containing codons.