Molecular Biology Databases
Molecular Biology Databases. Tour of the major molecular biology databases. A database is an indexed collection of information There is a tremendous amount of information about biomolecules in publicly available databases.
Molecular Biology Databases
E N D
Presentation Transcript
Tour of the major molecular biology databases • A database is an indexedcollection of information • There is a tremendous amount of information about biomolecules in publicly available databases. • Today, we will just look at some of the main databases and what kind of information they contain.
Data about Databases • Nucleic Acids research publishes an annual database issue. 2009 issue lists 1170 editorially selected databases (link on course web site) • Small excerpt from the A's: • AARSDB: Aminoacyl-tRNAsynthetase sequences • ABCdb: ABC transporters • AceDB: C. elegans, S. pombe, and human sequences and genomic information • ACTIVITY: Functional DNA/RNA site activity • ALFRED: Allele frequencies and DNA polymorphisms
Located Sequence Features • Indexing relevant data isn’t always easy • Naming schemes are always in flux, vary across communities, and are often controversial. • Descriptions of phenotypes are very difficult to standardize (even many clinical ones) • Genome sequences provide a clear reference • A “located sequence feature” (place on a chromosome) is unambiguous and biologically meaningful • Closely related to the molecular concept of a gene.
What can be discovered about a gene by a database search? • Best to have specific informational goals: • Evolutionary information: homologous genes, taxonomic distributions, allele frequencies, synteny, etc. • Genomic information: chromosomal location, introns, UTRs, regulatory regions, shared domains, etc. • Structural information: associated protein structures, fold types, structural domains • Expression information: expression specific to particular tissues, developmental stages, phenotypes, diseases, etc. • Functional information: enzymatic/molecular function, pathway/cellular role, localization, role in diseases
Using a database • How to get information out of a database: • Summaries: how many entries, average or extreme values; rates of change, most recent entries, etc. • Browsing: getting a sense of the kind and quality of information available, e.g. checking familiar records • Search: looking for specific, predefined information • “Key” to searching a database: • Must identify the element(s) of the database that are of interest somehow: • Gene name, symbol, location or other identifying information. • Sequences of genes, mRNAs, proteins, etc. • A crossreference from another database or database generated id.
Searching for informationabout genes and their products • Gene and gene product databases are often organized by sequence • Genomic sequence encodes all traits of an organism. • Gene products are uniquely described by their sequences. • Similar sequences among biomolecules indicates both similar function and an evolutionary relationship • Macromolecular sequences provide biologically meaningful keys for searching databases
Searching sequence databases • Starting from a sequence alone, find information about it • Many kinds & sources of input sequences • Genomic, expressed, protein (amino acid vs. nucleic acid) • Complete or fragmentary sequences • Goal is to retrieve a set of similar sequences. • Exact matches are rare, and not always interesting • Both small differences (mutations) and large (not required for function) within “similar” sequences can be biologically important.
What might we want to know about a sequence? • Is this sequence similar to any known genes? How close is the best match? Significance? • What do we know about that gene? • Genomic (chromosomal location, allelic information, regulatory regions, etc.) • Structural (known structure? structural domains? etc.) • Functional (molecular, cellular & disease) • Evolutionary information: • Is this gene found in other organisms? • What is its taxonomic tree?
NCBI and Entrez • One of the most useful and comprehensive database collections is the NCBI, part of the National Library of Medicine. • Home to GenBank, PubMed & many other familiar DBs. • NCBI provides interesting summaries, browsers, and search tools • Entrez is their database search interfacehttp://www.ncbi.nlm.nih.gov/Entrez • Can search on gene names, chromosomal location, diseases, articles, keywords...
BLAST: Searching with a sequence • Goals is to find other sequences that are more similar to the query than would be expected by chance (and therefore are likely homologous). • Can start with nucleotide or amino acid sequence, and search for either (or both) • Many options • E.g. ignore low information (repetitive) sequence, set significance critical value • Defaults are not always appropriate: READ THE NCBI EDUCATION PAGES!
A demonstration sequence atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaagtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagttcgtattaagatggtggctgtaggaatctgtggcacagatgaccacgtggttagtggtaccatggtgaccccacttcctgtgattttaggccatgaggcagccggcatcgtggagagtgttggagaaggggtgactacagtcaaaccaggtgataaagtcatcccactcgctattcctcagtgtggaaaatgcagaatttgtaaaaacccggagagcaactactgcttgaaaaacgatgtaagcaatcctcaggggaccctgcaggatggcaccagcaggttcacctgcaggaggaagcccatccaccacttccttggcatcagcaccttctcacagtacacagtggtggatgaaaatgcagtagccaaaattgatgcagcctcgcctctagagaaagtctgtctcattggctgtggattttcaactggttatgggtctgcagtcaatgttgccaaggtcaccccaggctctacctgtgctgtgtttggcctgggaggggtcggcctatctgctattatgggctgtaaagcagctggggcagccagaatcattgcggtggacatcaacaaggacaaatttgcaaaggccaaagagttgggtgccactgaatgcatcaaccctcaagactacaagaaacccatccaggaggtgctaaaggaaatgactgatggaggtgtggatttttcatttgaagtcatcggtcggcttgacaccatgatggcttccctgttatgttgtcatgaggcatgtggcacaagtgtcatcgtaggggtacctcctgattcccaaaacctctcaatgaaccctatgctgctactgactggacgtacctggaagggagctattcttggtggctttaaaagtaaagaatgtgtcccaaaacttgtggctgattttatggctaagaagttttcattggatgcattaataacccatgttttaccttttgaaaaaataaatgaaggatttgacctgcttcactctgggaaaagtatccgtaccattctgatgttttgagacaatacagatgttttcccttgtggcagtcttcagcctcctctaccctacatgatctggagcaacagctgggaaatatcattaattctgctcatcacagattttatcaataaattacatttgggggctttccaaagaaatggaaattgatgtaaaattatttttcaagcaaatgtttaaaatccaaatgagaactaaataaagtgttgaacatcagctggggaattgaagccaataaaccttccttcttaaccatt
Major choices: • Translation • Database • Filters • Restrictions • Matrix
Distant hit:L-threonine 3-dehydrogenase from a thermophilic bacterium
Taxonomy report (link from “Results of BLAST” page)
What did we just do? • Identify loci (genes) associated with the sequence. Input was human Alcohol Dehydrogenase 1A • For each particular “hit”, we can look at that sequence and its alignment in more detail. • See similar sequences, and the organisms in which they are found. • But there’s much more that can be found on these genes, even just inside NCBI…
NCBI is not all there is... • Links to non-NCBI databases (see also “Link Out”) • Reactome for pathways (also KEGG) • HGNC for nomenclature • HPRD protein information • Regulatory / binding site DBs (e.g. CREB; some not linked) • IHOP (information hyperlinked over proteins) • Other important gene/protein resources not linked: • UniProt (most carefully annotated) • PDB (main macromolecular structure repository) • UCSC (best genome viewer & many useful ‘tracks’) • DIP / MINT (protein-protein interactions) • More: InterPro, MetaCyc, Enzyme, etc. etc.
… …
Take home messages • There are a lot of molecular biology databases, containing a lot of valuable information • Not even the best databases have everything (or the best of everything) • These databases are moderately well cross-linked, and there are “linker” databases • Sequence is a good identifier, maybe even better than gene name!
Homework • Pick a favorite gene (or, if you don’t know any, how about looking up one of my favorites, PPAR-Delta) and gather information about it from at least five distinct resources. • Readings: • Nucleic Acids Researchonline Molecular Biology Database Collection in 2009Nucl. Acids Res. 2009 37: D1-D4doi:10.1093/nar/gkn942 • also, browse some of the entries themselves. • NCBI tutorial, Entrez: Making use of its power.