Identification of Differentially Expressed Genes in Carrot Seed Spine Formation
Explore the molecular mechanism of spine development in carrot seeds using ACP-based RT-PCR techniques to identify spine-specific genes. Differential expression of 11 genes was observed, shedding light on the regulatory roles in spine formation. Real-time RT-PCR verified gene regulation during seed development. This study signifies the utility of PCR-based techniques in uncovering seed development genes.
Identification of Differentially Expressed Genes in Carrot Seed Spine Formation
E N D
Presentation Transcript
Differentiallyexpressed genes involved in spine formation on seed of carrot SanggyuPark*, InSunKim1, Jong-SugPark2 Division of Life & Environmental Science, DaeguUniv., 1Biology Department, KeimyungUniversity, 2Plant Metabolite Engineering Team, NIAB AbstractTo understand the molecular mechanism of spine development in carrot seed, differentiallyexpressed genes of interest could be identified using an annealing control primer system. We employed a new and accurate reverse transcription-polymerasechain reaction (RT-PCR) that involves annealing control primers (ACPs) to identify the genes that are specifically or prominently expressed in normal spiny seed. Using these techniques, a total of eleven expressed sequence tags (ESTs) of genes that were differentiallyexpressed in normal spiny seeds, as compared to spineless mutant seeds, were cloned and sequenced. Seven cDNAsexhibited significant sequence similarity with known genes (Cell wall-associated hydrolase, Tail fiber assembly protein, Transcriptional regulatory protein, Berberinebridge enzyme, S-adenosylmethioninesynthase, Transketolase, Phenylalanylt-RNA synthetasebeta chain) of other species. On the other hand, four cDNAsequences had no significant identity to known genes. As revealed by real time RT-PCR, these genes were regulated spine formation during developmental stage. These results suggest that PCR-based differential display RT-PCRtechniques is a very useful tool for the identification of spine-specific genes of carrot seed development. ----------------------------------------- ACP-based GeneFishingTM PCR Differential expression of spine-specific genes Sequence-specific Primers used for RT-PCR Spiny (Left) and Spineless (Right) Carrot Seed Product length (bp) GenBank accession number Clone name Primer name Sequence GP1 GP15 GP43 GP48 GP57 GP58 GP68 GP77 GP87 GP101 GP115 40S Ribo GP1-S GP1-AS GP15-S GP15-AS GP43-S GP43-AS GP48-S GP48-AS GP57-S GP57-AS GP58-S GP58-AS GP68-S GP68-AS GP77-S GP77-AS GP87-1-S GP87-1-AS GP101-S GP101-AS GP115-1-S GP115-1-AS Ribo-S Ribo-AS DQ201832 DQ201833 DQ201834 DQ201835 DQ201836 DQ201837 DQ201838 DQ201839 DQ201840 DQ201842 DQ201841 DQ201843 150 264 155 181 302 155 263 246 264 210 262 350 TCGCAGTTCTAGTATCTTATG GGTGCCCATAGATATAAAATAAA GCAGTTCCCCAACACAG CCTCATCACTTGAACTGGA AAGACTCCAGCTGATCTTCA TTCTCGACTCTCAAACAGGT GTCATTGGAAAGACTCCAG GGAAGCGAACGATTGGTAT GAAGACCATCTTTCACCTCA TTTCCAGTTCCATAGGTGTC CGTGTGCGAACTTTAATTTTAC CCGAAGATATGATAAATAACAGAA CTGGTCGAACAGAGACG ACGGCAGATAGGAACCG GCCAGCGCAAAGGCATA GATTGAACTCTCTTGCTACAT GCGCATCAGCACTCGTT TTGCAAACTGATTTTATTATTGGTA GCATACAGAAATTTAAATCCCAA TGTATGTTTGTTTCCTTTGGATT GCATCAGCACTCGTTTTAG TTGCAAACTGATTTTATTATTATTGGTA CTGGTCTTGAACCAACTGA CAAGCATAGCATCATGAACA Schematic Depiction of the ACP RT-PCR GeneFishing The mRNAs isolated from wild type (spines on the seed testa) and mutant (spineless on the seed testa) carrot seeds were used for the synthesis of first-strand cDNA using the dT-ACP1 primer. The second-strand cDNAs were then amplified during second stage PCR by using a combination of dT-ACP2 (reverse primer) and one of 120 arbitrary ACP primers (forward primer). The products were then separated on an agarose gel to identify the DEGs that show greater expression in wild type than mutant.------- -------------------------------- Confirmation by RT-PCR of Differential mRNA expression Confirmation by RT-PCR of the differential mRNA expression patterns of 11 genes that were identified by ACP RT-PCR as being DEGs. The expression patterns of the 11 DEGs in wild type and mutant were compared by RT-PCR. The amplified DNA products were separated on an 1.2% agarose gel The ribosome gene was used as a control to confirm the integrity of the mRNA samples.— ---------- Primer Sequences for ACP-based PCR Use Primer name Sequence dT-ACP1 dT-ACP2 ACP1 ACP15 ACP43 ACP48 ACP57 ACP58 ACP68 ACP77 ACP87 ACP101 ACP115 5’-CTGTGAATGCTGCGACTACGATIIIII(T)18-3’ 5’-CTGTGAATGCTGCGACTACGATIIIII(T)15-3’ 5’-GTCTACCAGGCATTCGCTTCATIIIIIGCCATCGACC-3’ 5’-GTCTACCAGGCATTCGCTTCATIIIIICCACCGTGTG-3’ 5’-GTCTACCAGGCATTCGCTTCATIIIIIAGAAGCCGTC-3’ 5’-GTCTACCAGGCATTCGCTTCATIIIIIAGAAGCCTGC-3’ 5’-GTCTACCAGGCATTCGCTTCATIIIIIAGCCGACCTC-3’ 5’-GTCTACCAGGCATTCGCTTCATIIIIIATAAGATTGT-3’ 5’-GTCTACCAGGCATTCGCTTCATIIIIIACCGACTGGT-3’ 5’-GTCTACCAGGCATTCGCTTCATIIIIICTCCGATGCC-3’ 5’-GTCTACCAGGCATTCGCTTCATIIIII-GGCAACGGCG3’ 5’-GTCTACCAGGCATTCGCTTCATIIIIICCCTGGAACT-3’ 5’-GTCTACCAGGCATTCGCTTCATIIIIIATACGGGCCC-3’ cDNA synthesis primer Reverse primer Arbitrary primer (forward primer) Reverse transcription of tatal RNA (100ng) was carried out at 50oC for 30 min, and inactivated at 96oC for 3 min. PCR amplification was performed with 25 cycles of denaturation at 94oC for 30sec, annealing at 60oC for 30sec, extention at 72oC for 2 min, and a final extension at 72oC for 10 min. ------- ACP, annealing control primer The polydeoxyinosine [poly(dI)] linkers are underlined. I represents deoxyinosine Differential Expression of Genes Between Two Carrots (Spiny and Spineless) Identification of Carrot DEGs Clone No. % a.a sequence identity GenBank acc. No Identity Differential expression of genes/sequences between two Daucus carota L. (with and without spine formation). The results of ACP-based PCR for identification of differentially expressed genes (DEGs) from wild type (spines on the seed testa) and mutant (spineless on the seed testa) carrot seeds are shown. Gels are photographed to show differential banding patterns obtained from two different samples. Produced in vitro using a set of an arbitrary ACP (5’-primer) and dT-ACP2 (3’-primer). The amplified cDNA products are separated on 2% agarose gels and stained with ethidium bromide. These cDNA bands were excised from the gel for further cloning and sequencing. ---------------- Organism Putative cell wall protein Cell wall-associated hydrolase Tail fiber assembly protein Transcriptional regulatory protein 73% (90 a.a) 33% (42 a.a) 53% (26 a.a) Q8CME1 Q72C01 Q9COZ1 Vibrio vulnificus Desulfovibrio vulgaris Schizosacharomuces pombe GP68 GP87 GP101 Stress inducible enzyme Berberine bridge enzyme S-adenosyl methionine synthase Transketolase Phenylalanyl-tRNA synthetase GP48 GP57 GP58 GP115 50% (81 a.a) 97% (42 a.a) 84% (93 a.a) 33% (66 a.a) Arabidopsis thaliana Brassica juncea Spinacia oleracea Bacillus cereus Q570D1 Q94FA6 O20250 Q633N5 cDNA with no homology Unknown Unknown Unknown Unknown GP1 GP15 GP43 GP77 The sequence information was evaluated by comparing it with conceptual partial amino acid sequences deposited in public databases using the BLASTX program