1 / 24

Exploring DNA: Composition, Functions, and Mutations

Discover what chromosomes are made of, learn about DNA, its structure, function, and role in protein synthesis. Explore mutation types and genetic diseases like sickle cell anemia.

elvis
Télécharger la présentation

Exploring DNA: Composition, Functions, and Mutations

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. What are chromosomes made of?

  2. DNA Deoxyribonucleic Acid

  3. DNA • A type of Nucleic Acid • Genetic material in chromosomes. • Monomer made of: • Phosphate • Sugar (Deoxyribose) • Nitrogen Base • Monomer= Nucleotide

  4. DNA: Nitrogen Bases • Nitrogen Bases are the “steps” of the DNA “Ladder” • Adenine == Thymine (A-T) • Cytosine == Guanine (C-G) • Held together by Hydrogen Bonds

  5. DNA: You Try

  6. DNA: History • 1950’s Rosalind Franklin & Maurice Wilkens • Xray photography • Spiral structure

  7. DNA: History • 1950’s Watson & Crick • DNA consists of a double helix. • Two strands that are complements of each other. • Heredity is based on this chemical molecule!

  8. The Functions of DNA • Replication • Occurs during interphase. • Split your model and make two replicated strands!

  9. The Language of DNA • Sets of 3 nitrogen bases is a “word” called a codon. • Each segment of DNA that makes a protein is called a gene. ATCCGTACTAACGTACATTGC C0D0N GENE

  10. The Functions of DNA • Protein Synthesis • One gene codes for one protein DNA --> mRNA --> Protein TranscriptionTranslation

  11. How Proteins are Made • DNA can not leave the nucleus. • Messenger is needed to carry the information to the ribosome where the proteins are made.

  12. Ribonucleic Acid • A nucleic acid. • Single strand • Sugar = Ribose • Nitrogen bases: Cytosine == Guanine Adenine == Uracil • Types • mRNA, tRNA, rRNA

  13. Transcription • The synthesis of mRNA using DNA as the template. • DNA = T T C A T C • mRNA= A A G U A G

  14. Transcription Please turn to page 209 in the blue book and record the steps from the picture in your notes.

  15. How to Read a Codon Sheet Stop Codon Stop Start Codon

  16. Translation: Let’s Try! • The process of building a protein at a ribosome where the mRNA determines the sequence of amino acids in the protein. • mRNA= A A G U A G • Amino Acids/Codons= Lysine, Stop Codon

  17. Translation

  18. Translation Animation http://www.concord.org/~btinker/workbench_web/models/DNAmsgON.swf

  19. Translation • The ribosome reads the mRNA sequence and translates it into the amino acid sequence of the protein. • The ribosome starts at the sequence AUG, then reads three nucleotides at a time. • Each 3 nucleotide codon specifies a particular amino acid. • The stop codons (UAA, UAG, UGA) tell the ribosome that the protein is complete.

  20. (Nucleus)

  21. Mutations Mutation: Any change in the nucleotide sequence of DNA.

  22. Mutation Types Point Mutation (Base Substitution) Replacement of one nitrogen base for another.

  23. Mutation Types Silent Mutation: The change in the nitrogen base makes no difference in the coded amino acid.

  24. Mutation Example • Sickle Cell Anemia Sickle cell anemia is the most common inherited blood disorder in the United States. • SCA is genetic disease caused by a point mutation in the hemoglobin beta gene.

More Related