110 likes | 216 Vues
Protein Synthesis. DNA structure. (see video). DNA vs. RNA. Dna vs. rna. (see video). Central dogma. DNA is used to make RNA, and RNA is used to make proteins. DNA RNA protein. transcription. translation. TRanscription. Occurs in nucleus
E N D
DNA structure (see video)
Dnavs.rna (see video)
Central dogma • DNA is used to make RNA, and RNA is used to make proteins. DNA RNA protein transcription translation
TRanscription • Occurs in nucleus • RNA polymerase copies a gene from DNA • DNA used as a template • mRNA created, then leaves the nucleus
TRanscription (see video)
translation (see video)
translation • Occurs on a ribosome • 1. Ribosome uses rRNA to find start codon (sets the reading frame) • 2. First tRNAwith complimentary anti-codon attaches • 3. Next tRNA with complimentary anti-codon attaches • 4. Ribosome joins together the amino acids the tRNA molecules are carrying • 5. The ribosome continues joining amino acids until a special “stop” codon is reached
Important ideas Non-Template DNA Template DNA GTCGATGTCTTCAAGGCCCTTGTCGTAGGGT CAGCTACAGAAGTTCCGGGAACAGCATCCCA GUCGAUGUCUUCAAGGCCCUUGUCGUAGGGU “reading frame” set once start codon (AUG) is located AGU AGA UAC AGC UCC AAC GGG STOP mRNA met ser asn gly ser arg ser Finished sequence of amino acids = polypeptide (protein) tRNA w/anti-codon carrying amino acid (amino acid names are abbreviated)
Codon chart • Examples: • Codon #1 = • U A U • Codon #2 = • A G U • Codon #3 = • U A G