Download
primer design restriction analysis 2 nd april 2014 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Primer Design & Restriction Analysis 2 nd April 2014 PowerPoint Presentation
Download Presentation
Primer Design & Restriction Analysis 2 nd April 2014

Primer Design & Restriction Analysis 2 nd April 2014

206 Views Download Presentation
Download Presentation

Primer Design & Restriction Analysis 2 nd April 2014

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Primer Design & Restriction Analysis2nd April 2014 Carrie Iwema, PhD, MLS, AHIP Information Specialist in Molecular Biology Health Sciences Library System University of Pittsburgh iwema@pitt.edu http://www.hsls.pitt.edu/molbio

  2. Goals: • PCR primer construction & analysis • Restriction digestion & mapping http://www.hsls.pitt.edu/molbio

  3. Tools: • Primer Analysis & Design • NetPrimer • Primer3Plus • Primer-BLAST • Restriction Mapping • NEBcutter • Webcutter http://www.hsls.pitt.edu/molbio

  4. Primer Analysis & Design A little something to get you in the mood… http://www.hsls.pitt.edu/molbio

  5. Polymerase Chain Reaction (PCR) 1983-Kary Mullis • very simple • exponential amplification • similar to natural DNA replication The primary reagents, used in PCR are: • TemplateDNA–DNA sequence to amplify • DNA nucleotides–building blocks for new DNA • Taqpolymerase–heat stable enzyme catalyzes new DNA • Primers–single-stranded DNA, ~20-50 nucleotides, complimentary to a short region on either side of template DNA http://www.hsls.pitt.edu/molbio

  6. Polymerase Chain Reaction (PCR) • Raise temperature (94-98), denature DNA strands • Lower temp (50-65), anneal primers • Increase temp (72-80), allow time for extensions • Repeat process 25-40X http://www.hsls.pitt.edu/molbio

  7. Things to consider for primer design… • Primer-Dimer formation • Secondary Structures in Primers • Illegitimate Priming in Template DNA due to repeated sequences • Incompatibility with PCR conditions SOURCE: NCBI http://www.hsls.pitt.edu/molbio

  8. Primer-Dimer formation SOURCE: NCBI • homology within a primer (self dimer) or between the sense and anti-sense primer (cross dimer) • bonding of the two primers, increasing primer-dimerartifact and reducing product yields • particularly problematicwhen the homology occurs at the 3' endof either primer http://www.hsls.pitt.edu/molbio

  9. Self Dimer (example) SOURCE: NCBI internal dimer 3’ end dimer • The primer sequence is ATCAGCTGTAGAT • It forms 2 dimers: • internal dimerwhere 3rd-8th bases of primer in 5‘3' (starting from 5') bond with 6th-11th bases (starting from 3') when primer is placed in reverse direction • 3' end dimerwhere the last 3 bases (starting from 5') of primer placed in 5‘3' direction bond with last three base (starting from 3') placed in reverse direction. http://www.hsls.pitt.edu/molbio

  10. Cross Dimer (example) 3’ cross dimer • Sense primer sequence is ATCAGCTGTAGAT • Anti-sense primer sequence is ATAGTGTAGAT • Forms one cross dimerat the 3' end SOURCE: NCBI http://www.hsls.pitt.edu/molbio

  11. Secondary Structure in Primers • Hairpin loop • formed when primer folds back upon itself • held in place by intramolecular bonding • can occur with as few as 3 consecutive homologous bases • stability measured by the free energy The free energy of the loop is based upon the energy of the intramolecular bond and the energy needed to twist the DNA to form the loop. • If free energy >0, the loop is too unstable to interfere with the reaction • If free energy <0, the loop could reduce the efficiency of amplification http://www.hsls.pitt.edu/molbio

  12. Hairpin Loop (example) SOURCE: NCBI 3’ end hairpin internal hairpin • The primer sequence is ATCGATATTCGAAGAT • It forms two hairpins: • 3' end hairpinwhere the primer folds back upon itself and first and last 3 bases bond together • internal hairpinwhere 2nd-5th and 9th-12th bases bond together http://www.hsls.pitt.edu/molbio

  13. Basic Primer Analysis & Design Software • NetPrimer • http://www.premierbiosoft.com/netprimer/ • Primer3Plus • http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi • Primer-BLAST • http://www.ncbi.nlm.nih.gov/tools/primer-blast/ http://www.hsls.pitt.edu/molbio

  14. NetPrimer • http://www.premierbiosoft.com/netprimer/ • From PREMIER Biosoft • Free • Major features: • Primer properties: Tm , molecular weight, GC%, optical activity (both in nmol/A260 & µg/A260), DG, 3' end stability, DH, DS, and 5' end DG • Secondary structures: Hairpins, dimers, cross dimers, palindromes, repeats and runs • Primer rating: Quantitative prediction of the efficiency of a primer • Comprehensive report: Prints complete primer analysis for an individual primer or primer pair • Primer pairs: Analyze individual primers or primer pairs • Comprehensive help: Details all the formulas and references used in primer analysis algorithm http://www.hsls.pitt.edu/molbio

  15. NetPrimer Enter sequence here http://www.hsls.pitt.edu/molbio

  16. NetPrimer—sense primer http://www.hsls.pitt.edu/molbio

  17. NetPrimer—help http://www.hsls.pitt.edu/molbio

  18. NetPrimer—theories & formulas http://www.hsls.pitt.edu/molbio

  19. NetPrimer—antisense primer http://www.hsls.pitt.edu/molbio

  20. NetPrimer—antisense hairpin The most negative (i.e., most stable) DG is used for calculating the rating. http://www.hsls.pitt.edu/molbio

  21. NetPrimer—antisense dimer http://www.hsls.pitt.edu/molbio

  22. NetPrimer—cross dimer http://www.hsls.pitt.edu/molbio

  23. NetPrimer—3’ & 5’ stability An ideal primer has a stable 5' end and an unstable 3' end. Unstable 3’ = limits bonding to false priming sites. The lower this value, numerically, the more liable the primer is to show secondary bands. less negative = less false priming. Stable 5’ = called the GC Clamp, it increases bonding to the target site. The lower this value, numerically, the more efficient is the primer. more negative = better bonding. http://www.hsls.pitt.edu/molbio

  24. NetPrimer—rating The rating of a primer provides a quick way of measuring the predicted efficiency of a primer as well as choosing between closely matched primers. The higher the rating of a primer, the higher its amplification efficiency. http://www.hsls.pitt.edu/molbio

  25. NetPrimer—DG DG= DH – T * DS = free energy of the primer DH = enthalpy (internal energy) of primer T = temperature DS = entropy (unavailable energy) of primer Example: primer sequence = ATTCGCGGATTAGCCGAT DG = -154500 cal/mol – (298.15 * -403 cal/°K/mol) = -34.35 kcal/mol Rating = 100 + [(DG dimer * 1.8) + (DG hairpin * 1.4)] Example: 100 + [(-10.36 kcal/mol * 1.8) + (-3.28 * 1.4)] 100 + [-18.648 + -4.592] 100 + -23.24 76.76 The higher the rating, the better! http://www.hsls.pitt.edu/molbio

  26. NetPrimer—practice primers Rank these primers with attention to rating, 5’ end DG, and 3’ end stability • atgtgcgaggagaaagtgct • acaaaccctggacttgcatc • cgacttgtcccaggtgtttt • ctgaaaccattggcacacac • ggctgtgaacatggacattg • ggctgaagccaaagctacac http://www.hsls.pitt.edu/molbio

  27. NetPrimer • Ideal for checking primers • To create primers, try Primer3Plus http://www.hsls.pitt.edu/molbio

  28. Primer3Plus • http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi • Select primer pairs to detect a given template sequence • Targets and included/excluded regions can be specified • Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Human Press, Totowa, NJ, pp 365-386 http://www.hsls.pitt.edu/molbio

  29. Primer3Plus http://www.hsls.pitt.edu/molbio

  30. Primer3Plus Design PCR primers to amplify sub region of the sequence (600bp-2600bp) with product size 1800bp-2000bp. http://www.hsls.pitt.edu/molbio

  31. Primer3Plus—getting started click here to retrieve sample sequence, then copy/paste into box http://www.hsls.pitt.edu/molbio

  32. Primer3Plus Design PCR primers to amplify sub region of the sequence (600bp-2600bp) with product size 1800bp-2000bp. http://www.hsls.pitt.edu/molbio

  33. Primer3Plus Design PCR primers to amplify sub region of the sequence (600bp-2600bp) with product size 1800bp-2000bp. http://www.hsls.pitt.edu/molbio

  34. Primer3Plus—results http://www.hsls.pitt.edu/molbio

  35. Primer3Plus—results http://www.hsls.pitt.edu/molbio

  36. Primer3Plus—results http://www.hsls.pitt.edu/molbio

  37. Primer3Plus—Primer3Manager http://www.hsls.pitt.edu/molbio

  38. Primer3Plus—check primers http://www.hsls.pitt.edu/molbio

  39. Primer3Plus—check primers http://www.hsls.pitt.edu/molbio

  40. Primer3Plus—primer info http://www.hsls.pitt.edu/molbio

  41. Primer3Plus—BLAST primers http://www.hsls.pitt.edu/molbio

  42. Primer3Plus—BLAST primers http://www.hsls.pitt.edu/molbio

  43. Primer3Plus—check w/NetPrimer How good are these primers? Analyze with NetPrimer! http://www.hsls.pitt.edu/molbio

  44. Primer3Plus—NetPrimer sense Left (F) primer http://www.hsls.pitt.edu/molbio

  45. Primer3Plus—NetPrimer sense http://www.hsls.pitt.edu/molbio

  46. Primer3Plus—NetPrimer antisense Right (R) primer http://www.hsls.pitt.edu/molbio

  47. Primer3Plus—NetPrimer antisense http://www.hsls.pitt.edu/molbio

  48. Primer-BLAST • http://www.ncbi.nlm.nih.gov/tools/primer-blast/ • Combines primer design (Primer3) and a specificity check (BLAST) • Can also be used w/pre-designed primers • ref: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3412702/ http://www.hsls.pitt.edu/molbio

  49. Primer Design Tips • RT-PCR (to avoid unwanted amplification of genomic DNA) • Primer pair should span an intron Or • One of the primers should be at exon-exon junction • SNP issues • May cause mismatch, so pick primers outside of this region • qPCR • Specificity of amplification (amount of PCR product = fluor intensity) http://www.hsls.pitt.edu/molbio

  50. Primer-BLAST click here to retrieve sample sequence, then copy/paste into box http://www.hsls.pitt.edu/molbio