Download
molecular biology introduction n.
Skip this Video
Loading SlideShow in 5 Seconds..
MOLECULAR BIOLOGY Introduction PowerPoint Presentation
Download Presentation
MOLECULAR BIOLOGY Introduction

MOLECULAR BIOLOGY Introduction

455 Views Download Presentation
Download Presentation

MOLECULAR BIOLOGY Introduction

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. MOLECULAR BIOLOGYIntroduction Dr. drh. C. A. Nidom, MS.

  2. Function Genetics Biochemistry Proteins Genes Molecular Biology Molecular Biology • ...is the study of biology at a molecular level. • The field overlaps with other areas of biology, particularly genetics and biochemistry • Molecular biology concerns itself with understanding the interactions between the various systems of a cell, including the interrelationship of DNA, RNA and protein synthesis and learning how these interactions are regulated.

  3. Future of molecular biology • Personalised medicine • Target-specific drugs (e.g. adipose tissue) • Gene therapy • Comparative genomics

  4. Genetic Variation CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT CCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCT TCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGG GGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCA GGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTG TTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCAT TTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAA GGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATC CCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTG CTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTT GTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAAT AAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGG CAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACA TCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTT AAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATG TGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAA CACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAA TTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCT GTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTCCCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACC CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT GCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACTATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGA CTGCCATTTTCT TCACACCTGTCG TCTGCCTCTGG GGTTTTATTTTCT GCATTTCTACCA GGTTACAGGAAT GATATAGAATTG TTACAGTATATCA GGAAACAGCAT TTAAATTTAAAGC AGCCTGGAAAA GGCATTTTGGAA TGTACCAGATC CCACAGACTGAT TGGATGGTTTTG CTGAAAGCACCAA TCTCCTTATCTT GTGTCCAGAAAT AACAACATGAAT AAGAAGTTATTTC GAGGAAGTAGG CAGCTGACAGAA CAAGTACTTACA TCAATTGGGAAGA GTGGTTGATCTT AAGAACCTGCTT AGCCTGCAGATG TGGATCTAATGAT CACAACAACCAA CACTTTAAGATCT TGTGCTGGTAAA TTCACTCCATCGA AAGATTGATGCT GTGTATTGTCACT TTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGCTCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC

  5. Structure of DNA DNA Structure

  6. DNA function • Carries the blueprint for life • Duplication for new cells • Make proteins for biological functions:

  7. Central Dogma of Biology Assembly Protein Sequence Analysis Sequence analysis Gene Finding The information for making proteins is stored in DNA. There is a process (transcription and translation) by which DNA is converted to protein. By understanding this process and how it is regulated we can make predictions and models of cells.

  8. Language of Genetics Phenotype Proteins Genotype Central Dogma DNA RNAProtein Transcription Translation

  9. DNA • Stores all information of life • 4 “letters” base pairs. AGTC (adenine, guanine, thymine, cytosine ) which pair A-T and C-G on complimentary strands.

  10. 1944 AVERY, MAC LEOD & Mc. CARTHY • GENE IS A DNA • 1953 WATSON & CRICK • STRUCTURE OF DOUBLE HELIKS DNA • HOW IS DNA INFLUENCE PROTEIN SYNTHESIS??

  11. Herediter traits organism • GENE : • 1865 MENDEL: • (HEREDITARY FACTOR).

  12. DNA (DEOXYRIBONUCLEIC ACID) • Composition : • BASE : ADENIN (A) GUANIN (G) • TIMIN (T) SITOSIN (C) • SUGAR : 2- DEOXY RIBOSE • DOUBLE HELIX : • - COMPLEMENTER • - ANTIPARALLEL

  13. AMP GMP N N 5´ 4´ O O NH2 1´ NH2 N N O O 3´ 2´ O HO P N O HO P NH N N HO HO OH OH NH2 Phosphate Base Sugar CH3 NH2 O O O O 5´ N NH 4´ N N O 1´ 3´ 2´ O HO P O HO P HO O O HO OH OH TMP CMP DNA - Deoxyribonucleic acid

  14. DNA has a double helix structure. However, it is not symmetric. It has a “forward” and “backward” direction. The ends are labeled 5’ and 3’ after the Carbon atoms in the sugar component. • 5’ AATCGCAAT 3’ • 3’ TTAGCGTTA 5’ • DNA always reads 5’ to 3’ for transcription replication

  15. RNA • RNA is similar to DNA chemically. It is usually only a single strand. T(hyamine) is replaced by U(racil) • Some forms of RNA can form secondary structures by “pairing up” with itself. This can have change its properties dramatically. • DNA and RNA • can pair with • each other.

  16. Several types exist, classified by function • mRNA – this is what is usually being referred to when a Bioinformatician says “RNA”. This is used to carry a gene’s message out of the nucleus. • tRNA – transfers genetic information from mRNA to an amino acid sequence • rRNA – ribosomal RNA. Part of the ribosome which is involved in translation.

  17. DIFFERENT BETWEEN DNA & RNA • PENTOSE : • DEOXY RIBOSE ( DNA) & • RIBOSE (RNA) • NITROGEN BASE: • ADENIN, TYMIN, GUANIN, CYTOSIN • ( DNA) • ADENIN, URASIL, GUANIN, CYTOSIN • (RNA)

  18. MUTATION ON DNA • MUTASI : POINT (DELETION, INSERTION) • FRAME SHIFT MUTATION

  19. Splicing

  20. Polymerase Chain Reaction • Problem: Modern instrumentation cannot easily detect single molecules of DNA, making amplification a prerequisite for further analysis • Solution: PCR doubles the number of DNA fragments at every iteration

  21. 5’ 3’ 5’ 3’ Starting DNA Template 3’ 5’ 3’ 5’ Separate strands (denature) Forward primer 5’ 3’ 3’ 5’ 5’ 3’ 5’ 3’ Make copies (extend primers) Reverse primer Add primers (anneal) DNA Amplification by PCR

  22. Regio target DNA asli Cycles PCR DNA result of PCR After several cycles After 32 cycles will be resulted 1.07 miliyar copy of DNA

  23. MOLECULAR BIOLOGY • is the study of : • STUCTURES • TRAITS • FUNCTION………of life • BIOMOLEKUL DALAM PELAKSANAAN SEGALA ASPEK FUNGSI KEHIDUPAN

  24. MOLECULAR BIOLOGY • BIOLOGY CHEMISTRY • PHYSIOLOGYBIOCHEMISTRY • MOLECULAR BIOLOGY

  25. BIOLOGI : IS THE STUDY OF ORGANISM • ( ALL LIVING ASPECTS) • BIOCHEMISTRY is the study of structure & process of chemistry in a life organism • BIOLOGI SEL IS THE STUDY OF Cells are the basic units of life and all the chemical reactions of life occur in cells

  26. POSITION OF MOLECULAR BIOLOGY • SAINS, SCIENCE • * BASIC SCIENCES) • * APPLIED SCIENCES • VETRINARY SCIENCE : • APPLIED SCIENCES & CLINICAL : • DIAGNOSIS, • PATHOGENESIS • TREATMENT

  27. ORGANISM • LIFE FUNCTIONS : • 1. REPRODUCTION/REPLICATION • 2. HEREDITER OF TRAITS • 3. GROWTH • 4. METABOLISM FOR ENERGY • 5. HOMEOSTASIS • 6. TRANSPORTS • 7. COMMUNICATION BETWEEN CELLS.

  28. BASE ON ENERGY SOURCES, ORGANISM : • AUTOTROPHIC : Organism need INORGANIC Compound (CO2, H2O, NH3) for energy synthezising. • HETEROTROPHIC : • Organism need ORGANIC (CARBON) for their life. They can not synthezise all biomoleculs.

  29. MODERN CELL THEORY • All living things are made of one or • more cells • Cells are the basic units of life and all • the chemical reactions of life occur • in cells • 3. All cells arise from preexisting cells

  30. Cell Requirements take in materials extract useful energy make their own molecules grow in an organized manner respond to stimuli reproduce themselves Plasma membrane to maintain integrity

  31. All Bacteria No membrane bound organelles No microtubules flagella are single filaments single circular DNA molecule (not associated w/histone proteins). No true sexual reproduction Defined nucleus DNA stored as chromosomes (w/ histone proteins) Chromosomes regularly divide by Mitosis Flagella & cilia have 9-plus-2 pattern of microtubules Specialized organelles Integrated multicellularity Sexual reproduction (different types) Prokaryotes vsEukaryotes

  32. Prokaryotic Cell

  33. Eukaryotic Cell

  34. VIRUS? • UNCOMPLETED ORGANISM ! • VIRUS CAN GROW & REPLICATE IF THEY ARE IN A CELL.

  35. VIRUS • OUTSIDE OF CELL  VIRION • SIMPLE VIRION : • * NUCLEUS (CORE) : DNA/RNA • * NUCLEOCAPSID : PROTEIN • UNSIMPLE VIRION : • NUCLEUS, NUCLEOCAPSID, ENVELOP • (LIPID BILAYER), ENZYMES • Example : FMD (DNA), AI virus (RNA)

  36. Influenza Virus

  37. BIOMOLECULE: • CHEMICAL COMPOUND IS NATURALLY FOUND IN LIVING ORGANISM OR IN JUST DEATH ORGANISM • BASIC ATOMS FOR BIOMOLECULE : • C, H, O, N, S, P

  38. FUNCTIONS : • A. As STRUCTURAL COMPONENT OF CELL : • CONSTRUCT ORGANISM BODY, • Ex: CELL MEMBRANE, • CITOSCELETON, CELL MATRIX • B. As FUNCTIONAL COMPONENT OF CELL : • NEEDED FOR LIVE FUNCTIONS • Ex : ENZYMES , HORMONES, ANTIBODIES, • DNA, RNA, ATP.

  39. C. As STORED ENERGY ; Ex : TRIACYLGLYCEROL, GLYCOGEN D. As WASTE : • NON SPECIFIC FUNCTIONS • METABOLIC WASTE • Ex : UREUM , URIC ACID

  40. BASED ON STRUCTURE & MOLECULAR WEIGHT, BIOMOLECULE : • A. SIMPLE COMPOUND : • AMINO ACID, FATTY ACID • B. MACROMOLECULE : • POLYSACCARIDE, • POLYPEPTIDE (PROTEIN) • POLYNUCLEOTIDE (DNA, RNA)

  41. BIOMOLEKUL BERDASAR KELARUTANNYA • 1. SENYAWA HIDROFILIK : • PROTEIN, GLUKOSA, ASAM AMINO • 2. SENYAWA HIDROFOBIK : • TRIASILGLISEROL, KOLESTEROL • ESTER • 3. SENYAWA AMPIFILIK : • PENYUSUN MEMBRAN SEL : • SFINGOMIELIN, KOLESTEROL, • SEREBROSIDA

  42. MACROMOLECULE : • As POLYMER : • - HOMOPOLYMER : • - HETEROPOLIMER :

  43. SEKIAN • DAN • TERIMA KASIH