liuz
Uploaded by
7 SLIDES
229 VUES
70LIKES

Biotechnology

DESCRIPTION

Biotechnology. Genetic Engineering. Genetic Engineering. Allows scientists to manipulate the DNA (genome) of living things. Selective Breeding (original genetic engineering) Crossing organisms w/desired traits Selecting traits in animals – used inbreeding

1 / 7

Download Presentation
Télécharger la présentation

Biotechnology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Biotechnology Genetic Engineering

  2. Genetic Engineering • Allows scientists to manipulate the DNA (genome) of living things. • Selective Breeding (original genetic engineering) • Crossing organisms w/desired traits • Selecting traits in animals – used inbreeding • Domestic animals; dogs, cows, pigs, goats, sheep, etc. • Growing seeds from plants that had traits prefered • Example: the brassica family original plant:

  3. Brassica ancestral plant • Any guesses?

  4. Today’s Brassica Plants

  5. Introducing Mutations • Mutations are the ultimate source of biodiversity! • When mutations are isolated, they can then be introduced into populations. • Now that we can analyze & manipulate DNA • this can be done on the molecular level! • This can be done between different species! • Example: can use bacteria and viruses to insert DNA

  6. The Good & The Bad • Benefits: Recombinant DNA has applications in agriculture, industry, medicine & forensics. • Draw backs: There are ethical, legal, safety and social issues surrounding genetic engineering.

  7. How do scientists study and work with specific genes? • They use the smallest scissors! • To cut DNA into smaller pieces • Called Restriction Enzymes • It’s like using the “search” function. • Copy the following DNA sequence in your BFF. • GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA • Look carefully to find this specific series: • GTTAAC • When you find it, divide the sequence in half between the T and A. • How many occurrences? • How many fragments of DNA?

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer