70 likes | 226 Vues
Biotechnology. Genetic Engineering. Genetic Engineering. Allows scientists to manipulate the DNA (genome) of living things. Selective Breeding (original genetic engineering) Crossing organisms w/desired traits Selecting traits in animals – used inbreeding
E N D
Biotechnology Genetic Engineering
Genetic Engineering • Allows scientists to manipulate the DNA (genome) of living things. • Selective Breeding (original genetic engineering) • Crossing organisms w/desired traits • Selecting traits in animals – used inbreeding • Domestic animals; dogs, cows, pigs, goats, sheep, etc. • Growing seeds from plants that had traits prefered • Example: the brassica family original plant:
Brassica ancestral plant • Any guesses?
Introducing Mutations • Mutations are the ultimate source of biodiversity! • When mutations are isolated, they can then be introduced into populations. • Now that we can analyze & manipulate DNA • this can be done on the molecular level! • This can be done between different species! • Example: can use bacteria and viruses to insert DNA
The Good & The Bad • Benefits: Recombinant DNA has applications in agriculture, industry, medicine & forensics. • Draw backs: There are ethical, legal, safety and social issues surrounding genetic engineering.
How do scientists study and work with specific genes? • They use the smallest scissors! • To cut DNA into smaller pieces • Called Restriction Enzymes • It’s like using the “search” function. • Copy the following DNA sequence in your BFF. • GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA • Look carefully to find this specific series: • GTTAAC • When you find it, divide the sequence in half between the T and A. • How many occurrences? • How many fragments of DNA?