1. Chapter 26 Phylogeny & The Tree of life

2. Phylogeny: • Evolutionary history of a species or group of species • Determined by evidences from fossil record, homologous structures, molecular homologies • Systematics: • Helps us understand phylogeny (data analysis of phylogeny) Phylogeny & Systematics

3. Phylogenies show evolutionary relationships 26.1

4. Grouping according to evolutionary similarities • Binomial nomenclature (Linnaeus) • Domains  Species • Taxon (plural: taxa): named taxonomic hierarchy • Ex: Panthera is the taxon at the genus level Taxonomy

5. Link phylogeny and taxonomy Phylogenic Trees

6. Reading phylogenic trees

7. Phylogenies are inferred from morphological and molecular data 26.2

8. With ability to sequence DNA, we can easily show evolutionary relationships • EX: • Species 1: GAGATCTACACGGGGCCATGGAAAG • Species 2: GAGAACTACACGGGGCTATGGAAAG • Species 1: GAGATCTACACGGGGCCATGGAAAG • Species 3: GCCCACTATTATGGGCTATGGACCC DNA documentation

9. Shared characters are used to construct phylogenic trees 26.3

10. Science of constructing a cladogram Cladistics

11. Clades • Groups of organisms sharing a common ancestor Cladistics

12. A valid clade is monophyletic, it consists of the ancestor species and all its descendants Monophyletic

13. A paraphyletic clade consists of an ancestral species and some, but not all, of the descendants Paraphyletic

14. A polyphyletic clade includes many species that lack a common ancestor Polyphyletic

15. Species Change Over Time (Nodes)

16. Characteristics • Shared primitive character • Homologous structure that is older than the branching of a particular clade from other members of that clade • It is shared by more than just the taxon we are trying to define. • Example – mammals all have a backbone, but so do other vertebrates.

17. Characteristics • Shared derived character • New evolutionary feature, unique to a particular group • Example - all mammals have hair, and no other animals have hair.

18. Ingroup & Outgroup In: Group of study (make comparisons) Out: Group that diverged prior to ingroup

19. An organism’s evolutionary history is documented in its genome 26.4

20. Orthologous genes • Same gene, found in different species • Divergence traces back to speciation event • Ex: cytochrome c • Paralogous genes • Same gene, found in same species Genome evolution: Gene duplication

21. Molecular clocks help track evolutionary time 26.5

22. “Time” evolution by looking at how genes change Example: HIV Molecular clocks

23. New information continues to revise our understanding of the tree of life 26.6

24. 2 kingdoms to 3 domains