Chapter 16
Chapter 16. Molecular Basis of Inheritance. DNA genetic material. Chromosomes composed of DNA + protein. DNA base composition. Nucleotide base Guanine Cytosine Thymine Adenine. Guanine, C 5 H 5 N 5 O. DNA is a polymer of nucleotides. Chargaff’s rules (1950).
Chapter 16
E N D
Presentation Transcript
Chapter 16 Molecular Basis of Inheritance
DNA genetic material • Chromosomes composed of DNA + protein
DNA base composition Nucleotide base Guanine Cytosine Thymine Adenine Guanine, C5H5N5O
Chargaff’s rules (1950) [T] = [A] [G] = [C] A certain chromosome is 19% A. What is the % of C?
DNA structural model Watson, Crick, Franklin 1953 X-ray crystallography DNA is helical Spacing of bases Width of helix suggested 2 strands
DNA double helix Sugar-phosphate “backbone” Anti parallel strands
Bases face inward • Hydrogen bonds connect bases
A - T (2 bonds) G - C ( 3 bonds)
Original DNA copied to new DNA helix Original DNA broken up and combined in new DNA 1 strand original DNA maintained in new DNA
Meselson and Stahl 1950s • Label DNA (E. coli) with 15N in growth media 2. Transfer E. coli to 14N media for 1 generation (20 min)
Results: The density of the DNA is intermediate Cells grown longer 14N, make lighter DNA
What would the DNA density be after 20 more minutes of cell group? 14N DNA 1.710 gm/cm3 15N DNA1.724 gm/cm3
DNA replication: mechanism (E. coli) E. coli genome = 4 X 10 6 bp DNA 1 circular chromosome 1 origin of replication (ori)
Ori nucleotides • Replication proteins attach to ori • Forms a replication bubble • Two strands of DNA open
Proteins in DNA replication Table 16.1 • DNA polymerase (enzyme) Adds nucleotides 5’ 3’ direction only
2. Helicase (enzyme) – unwinds double helix 3. Single stranded binding protein (SSB) binds to DNA strands to stabilize them
4. Topoisomerase (enzyme) – breaks, rejoins DNA to relieve physical stress 5. Primase – synthesizes a primer
Leading strand is Lagging strand is Each strand is a template for new DNA
DNA replication leading strand: steps • Primase (enzyme) • synthesizes primer complementary to leading strand • primer is ~10 bases
2. DNA polymerase (pol III) synthesizes new strand 5’ 3’ G, A, T, C nucleotides complementary to template strand 500 nuc/sec Continuous elongation until end of chromosome
DNA Synthesis steps: lagging strand 1. Primase makes RNA primer 2. DNA adds nucleotides to primer in 5’ 3’ direction only
3. DNA pol III detaches Okazaki fragment • ~ 1, 000 nucleotides long
4. Another primer added, another Okazaki fragment formed Many primers needed
5. Gaps between primers filled in 6. Ligase enzyme bonds fragments
Linear DNA has telomeres • No genes • Repetitive DNA TTAGGG up to 1000 times 5'...TTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGG..3‘ 3'...AATCCC AATCCCAATCCCAATCCCAATCCC AATCCC..5' Human chromosomes capped by telomeres
When telomeres are too short cell senescence (irreversible) ~ 125 cell divisions (humans)……life span? Telomeres shorten ~100 bp each time cell divides Mouse fibroblasts in culture
Cells that do not divide often • Example: heart muscle Telomeres do not shorten with age
Lagging strand problem • Animation garland
Embryonic cells, some wbc, stem cells, cancer cells express telomerase White blood cell cervical cancer cell embryo