Download
chapter 13 genetic engineering n.
Skip this Video
Loading SlideShow in 5 Seconds..
Chapter 13: Genetic Engineering PowerPoint Presentation
Download Presentation
Chapter 13: Genetic Engineering

Chapter 13: Genetic Engineering

209 Vues Download Presentation
Télécharger la présentation

Chapter 13: Genetic Engineering

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Chapter 13: Genetic Engineering

  2. Modifying offspring’s appearance at the NON-DNA level • Selective Breeding • HOW: allowing only those animals with desired characteristics to produce the next generation • Pros: takes advantage of naturally occurring genetic variation in organisms • Cons: No guarantee you get what you want • EX: Breeding the winners of a horse race

  3. Hybridization • HOW: Crossing organisms of different traits to produce a hardier product • Pros: can get “best of both worlds” • Cons: not guaranteed you get desired traits • EX: A mule is a cross of a horse and a donkey – Sturdy (donkey) and surefooted (horse) • EX: Hybrid corn – tastes good and is more resistant to disease.

  4. ZEBROID • Cross between a zebra and a horse • Aka “zebra mule”, “zebrule”, “zorse”

  5. Jostaberry • Hybrid between gooseberry and blackcurrant +

  6. Broccoflower • Broccoli + cauliflower + =

  7. Chuman / Manpanzee • Chuman – male chimp, female human • Manpanzee- male human, female chimp • HYPOTHETICAL SPECIES • (not real)

  8. Why it doesn’t work • Wrong number of chromosomes • Sperm cannot penetrate egg • Post-zygotic reproductive barriers • Even if the egg got fertilized, it wouldn’t be recognized by mother and would spontaneously abort

  9. Inbreeding • HOW: Maintaining the present genes by breeding only within the population • Pros: Keeps family traits you want • Cons: recessive traits showing up that may be lethal or harmful. • EX: Pedigree animals

  10. Inducing mutations • How: using radiation & chemicals to alter DNA and force mutations to occur • Pros: new phenotypes • Concerns: Not a sure bet nor do you know what you are going to get • EX: Polyploidy (3N or 4N) plants have resulted from this – larger & hardier

  11. Selective Breeding Hybridization Inducing Mutations Inbreeding

  12. PROCESS BOX 13-1 What are two similarities between the four methods above? What are two differences between the four methods above? MUST BE AT LEAST 4 LINES LONG

  13. Glofish: the first genetically modified animal to be sold as a pet

  14. Modifying an organism directly at the DNA level • DNA Technology – science involved in the ability to manipulate genes/DNA • Purpose: • Cure disease (Cystic Fibrosis) • Treat genetic disorders (Hemophilia, diabetes) • Improve food crops (better tasting, longer shelf life, fungus resistance…) • Improve human life in general

  15. YOU CHOOSE! • Notecards (with pocket glued to notebook) • Vocab foldable

  16. The Tools: • DNA Extraction – Chemical procedure to remove DNA • Restriction enzymes– molecular scissors that cut DNA at specific nucleotide sequences • Gel Electrophoresis– method to analyze fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve) • DNA Ligase – molecular glue that puts pieces of DNA together • Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr

  17. Treatment of diseases • Several diseases have been “treated” in the past • Diabetics—injections of insulin from sheep • Problems?

  18. Treatment of Diseases • Several diseases have been “treated” in the past • Dwarfism– using hormones from pituitaries of cadavers • Problems

  19. Treatment of Diseases • Several diseases have been “treated” in the past • Hemophilia—using blood clotting factors from blood transfusions • Problems?

  20. New method of treating diseases • Overall Scheme: get bacteria to make what you want, harvest from bacteria • Called Recombinant DNA Technology

  21. What are restriction enzymes? • Bacterial enzymes – used to cut bacteriophage DNA (viruses that invade bacteria). • Different bacteria make different enzymes • Restriction enzymes recognize a specific short nucleotide sequence called a recognition site • Palindromes same base pairing forward and backwards

  22. Blunt & Sticky ends • Sticky ends – Creates an overhang. • EX: EcoRI • Blunt Ends- Enzymes that cut at precisely opposite sites without overhangs. • EX:SmaI

  23. PROCESS BOX 13-2 • Do you think that blunt ends or sticky ends are easier to reconnect? Why? MUST BE AT LEAST 2 LINES LONG

  24. Recombinant DNA technology • Isolate gene of interest from human (or other organism) • Cut with restriction enzyme • Cut cloning vector (bacterial plasmid or viral DNA) • Cut with same restriction enzyme • Want a genetic marker present (allows identification)

  25. Donor Gene Recombinant DNA technology • “Glue” gene of interest onto cloning vector • DNA ligase puts them together • At this point, you have created a piece of Recombinant DNA • Recombinant DNA - DNA with new piece of genetic information on it

  26. Recombinant DNA technology • Cloning vector goes into bacterium • Bacteria is called a transgenic organism--organism with foreign DNA incorporated in its genome (genes) • Screen for the bacteria that did transform by using genetic marker (antibiotic resistance) • Bacteria makes protein from gene of interest • Protein is used

  27. Ms. Lichtenwalner’s Maple Pig™ Dream

  28. PROCESS BOX 13-4 • Explain how to make Ms. Lichtenwalner’sMaplePig™ using the five steps of recombinant DNA technology above. Be as specific as possible. MUST BE AT LEAST 8 LINES LONG

  29. Benefits of DNA technology • Pharmaceutical products – insulin, HBCF (human blood clotting factor) • Genetically engineered vaccines – to combat viral infections (pathogenic – disease causing) • body recognizes foreign proteins, produces antibodies • Prevents future illness

  30. Benefits of DNA technology • Increasing agricultural yields –GMO – Genetically modified • Insect-resistant plants • Disease resistant plants • Herbicide resistant plants • Increase N fixation • Salt tolerant plants

  31. Benefits of DNA technology • Improve quality of produce • Slow down the ripening process – ship when un-ripened, to market when ripe • Enhance color of produce • Reduce hairs or fuzz on produce • Increase flavor • Frost resistance

  32. Negatives of DNA Technology • Food allergies • EX: May have peanut products in a non-peanut food and NOT KNOW! • FDA does not require that on a label (here in the US) • Also, may create “superweeds” that cross pollinate with others & may take over environment • Genetic resistance to our ways of chemically removing them • Health effects down the road?

  33. PROCESS BOX 13-4 • Do you think that the benefits of DNA technology outweigh the negatives of DNA technology? Defend you answer with two examples. MUST BE AT LEAST 3 LINES LONG

  34. Cloning—more DNA tech • What is it? • Growing a population of genetically identical cells from a single cell. • Landmark year • 1997 - Ian Wilmut with Dolly, the cloned sheep • First cloned mammal

  35. Cloning Process • Remove nucleus from egg cell • Fuse de-nucleated cell with a body cell from another adult • Cells become 2N and then divides • Implant embryo in reproductive system of foster mother

  36. Hello Dolly!

  37. PROCESS BOX 13-6 • Congress thinks the country has gone to shambles, and they plan to clone George Washington, the “first” (actually 7th) president of the United States. In the space below, outline a plan that explains how George Washington could be cloned. MUST BE AT LEAST 3 LINES LONG

  38. Polymerase Chain Reaction • Makes many copies of one piece of DNA by repeating replication

  39. DNA Fingerprinting—more DNA tech • Using cut DNA at specific sites to determine the source of the DNA. • Analyzes sections of DNA that have little to no function but vary greatly from one person to the next (called repeats) • RFLP analysis – We’ll do this in lab

  40. DNA Fingerprinting • RFLP analysis– Restriction fragment length polymorphism. We each have non-coding segments on our DNA. • Extract DNA sample from blood or tissues • Cut DNA using restriction enzymes. Fragment lengths varies with each person • Separate fragments by gel electrophoresis– separates DNA fragments by the # of base pairs (length of the fragment) and charge

  41. DNA Fingerprinting • Place DNA sample into wells in the agarose gel – molecular sieve • Run a current through the gel. The DNA (negatively charged) will migrate from (-) to (+) • The larger fragments will not migrate that far. The small fragments will go the furthest. • Stain gel and bands in a dye or use a radioactive probe to analyze the banding

  42. Variable Number Tandem Repeat • Aka VNTR • Small segments of DNA that are repeatedover and over • Varies from individual to individual • What is the repeat in this sequence? • TAACGTAACGTAACGTAACGTAACGTAACG