Workshop W6 Tutorial on RNA secondary structure

Jan 26, 2026

10 likes | 122 Vues

Join us for an informative workshop on RNA secondary structure led by Alain Laederach. This tutorial will dive into the essential concepts and methodologies for understanding RNA's complex structural features. Attendees will gain insights into RNA structure prediction and its significance in biological systems. Detailed slides from the session are available at the provided link. Enhance your knowledge of RNA biology and computational techniques to analyze secondary structures effectively. Don't miss this opportunity to learn from an expert in the field!

Share Presentation

Embed Code

nita-barron

Télécharger la présentation

Workshop W6 Tutorial on RNA secondary structure

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Workshop W6Tutorial on RNA secondary structure Alain Laederach Slides available at: http://ribosnitch.bio.unc.edu/Downloads/RNA2013/ #RNA2013, @alaederach

RNA Secondary Structure

RNA Secondary Structure. RNA Structure Prediction. FoldRNA Various graphic display options MFold PlotFold StemLoop. Structural Prediction Limitations. Gunnar von Heijne 1987

977 views • 59 slides

RNA secondary structure prediction and runtime optimization

RNA secondary structure prediction and runtime optimization. Greg Goldgof October 5, 2006 CS374 Presentation Stanford University. Presentation Overview. CONTRAfold: probabilistic RNA folding. Background on RNA secondary structure prediction.

768 views • 45 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. Lecture 11: June 13, 2006 Algorithms of Molecular Biology. Introduction to RNA Sequence/Structure Analysis. RNAs have many structural and functional uses Translation Transcription RNA splicing RNA processing and editing cellular localization catalysis.

1.31k views • 84 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. Dynamic Programming Approaches Sarah Aerni. http://www.tbi.univie.ac.at/. RNA folding Dynamic programming for RNA secondary structure prediction Covariance model for RNA structure prediction. Outline. RNA Basics. 3 Hydrogen Bonds – more stable.

1.51k views • 22 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. RNA is a single-stranded chain of the nucleotides A, C, G, and U. The string of nucleotides specifies the linear structure of the RNA strand. When RNA folds, complementary nucleotides form base pairs (CG and AU).

968 views • 36 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. 16s rRNA. RNA Secondary Structure. Pseudoknot. Dangling end. Single- Stranded. Interior Loop. Bulge. Junction (Multiloop). Stem. Hairpin loop. Image– Wuchty. RNA secondary structure. G A A A G G A-U U-G C-G

354 views • 16 slides

RNA Secondary Structure

RNA Secondary Structure. aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua aagccuucggagcgggcguaacuc. Hairpin Loops. Interior loops. Stems. Multi-branched loop. Bulge loop. A Context Free Grammar. S  AB Nonterminals: S, A, B

529 views • 33 slides

6.5 RNA Secondary Structure

6.5 RNA Secondary Structure. RNA Secondary Structure. RNA. String B = b 1 b 2  b n over alphabet { A, C, G, U }. Secondary structure. RNA is single-stranded so it tends to loop back and form base pairs with itself. This structure is essential for understanding behavior of molecule. C.

545 views • 8 slides

RNA Secondary Structure

RNA Secondary Structure. aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua aagccuucggagcgggcguaacuc. Stochastic Context Free Grammars. In an analogy to HMMs, we can assign probabilities to transitions: Given grammar

465 views • 30 slides

RNA Secondary Structure

RNA Secondary Structure. aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua aagccuucggagcgggcguaacuc. RNA and Translation. RNA and Splicing. Hairpin Loops. Interior loops. Stems. Multi-branched loop. Bulge loop.

544 views • 37 slides

RNA secondary structure

6.096 – Algorithms for Computational Biology. RNA secondary structure. Lecture 1 - Introduction Lecture 2 - Hashing and BLAST Lecture 3 - Combinatorial Motif Finding Lecture 4 - Statistical Motif Finding Lecture 5 - Sequence alignment and Dynamic Programming. 8. 2. 6. 9. 5. 7. 1.

1.66k views • 108 slides

Prediction of Secondary Structure of RNA

Prediction of Secondary Structure of RNA. Swetha Nandyala. Overview. Introduction How RNA Secondary Structure is obtained ? Various types of loops possible in RNA Secondary Structure Motivation Resource Implements the Algorithms to be Understood Algorithm Nussinovs RNA Folding Example.

524 views • 18 slides

RNA secondary structure prediction

Doug Raiford Lesson 7. RNA secondary structure prediction. Why do we care. RNA World Hypothesis RNA world evolved into the DNA and protein world DNA advantage: greater chemical stability Protein advantage: more flexible and efficient enzymes ( biomolecules that catalyze)

665 views • 28 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. Spring 2010. Objectives. Can we predict the structure of an RNA? Can we predict the structure of a protein?. RNA: Hypothesis and exclusions. Single stranded chain A RNA molecule is a string of n characters R=r 1 r 2 …r n such that r i  {A,C,G,U}

517 views • 32 slides

RNA: Secondary Structure Prediction and Analysis

RNA: Secondary Structure Prediction and Analysis. Outline. RNA Folding Dynamic Programming for RNA Secondary Structure Prediction Covariance Model for RNA Structure Prediction Small RNAs: Identification and Analysis. Section 1: RNA Folding. RNA bases: A,C,G,U Canonical Base Pairs A-U

1.65k views • 94 slides

RNA Bioinformatics Genes and Secondary Structure

RNA Bioinformatics Genes and Secondary Structure. Anne Haake Rhys Price Jones & Tex Thompson. Types of RNA. Coding mRNA (messenger) Non-Coding rRNA (ribosomal) tRNA (transfer) snRNA (small nuclear;splicing) RNAseP (ribozyme) siRNA (small inhibitory) Others…. RNA genes?. Recall:

432 views • 28 slides

RNA Secondary Structure

RNA Secondary Structure. aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua aagccuucggagcgggcguaacuc. Decoding: the CYK algorithm. Given x = x 1 ....x N , and a SCFG G, Find the most likely parse of x

567 views • 44 slides

Arc-Segment Alignment for RNA Secondary Structure

Arc-Segment Alignment for RNA Secondary Structure. 指導教授：楊昌彪學生姓名：彭永興. The Longest Common Subsequence (LCS) Problem. A string : S 1 = “ TAGTCACG ” A subsequence of S 1 : deleting 0 or more symbols from S 1 (not necessarily consecutive). e.g. G , AGC , TATC , AGACG

226 views • 12 slides

Secondary Structure Prediction (Mostly RNA)

Secondary Structure Prediction (Mostly RNA). An example of RNA structure. RNA secondary structures. A real example - tRNA. Conserved structures. Building a grammar. An example grammar. Grammar for a protein motif. Example Hidden Markov Models.

238 views • 9 slides

RNA Secondary Structure

440 views • 27 slides

RNA Secondary Structure

RNA Secondary Structure. What is RNA? Definition of RNA secondary Structure RNA molecule evolution Algorithms for base pair maximisation Chomsky’s Linguistic Hierarchy Stochastic Context Free Grammars & Evolution Miscelaneous topics. Base Pairing From Przytycka. An Example: t-RNA.

494 views • 40 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. Dynamic Programming Approaches Sarah Aerni. http://www.tbi.univie.ac.at/. RNA folding Dynamic programming for RNA secondary structure prediction. Outline. RNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C

628 views • 16 slides

More Related