1 / 1

This following is a depiction of an mRNA:

Quiz 2: Biol 203 2013. Lab Instructor Name:. Section: ___ Time of lab:______8 th or 9 th floor (circle). Name:_______________. This following is a depiction of an mRNA: (4pts) If possible, draw out on the line below the most likely genomic structure for the above mRNA

norris
Télécharger la présentation

This following is a depiction of an mRNA:

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Quiz 2: Biol 203 2013 Lab Instructor Name: Section: ___ Time of lab:______8th or 9th floor (circle) Name:_______________ • This following is a depiction of an mRNA: • (4pts) If possible, draw out on the line below the most likely genomic structure for the above mRNA • and make sure you put the Gcap and pA tail where it belongs. • They should draw nothing or say that it is not possible to predict a “most likely” genomic structure • B) (4pts) This following sequence (two rows) represents a COMPLETE cDNA. • Please underline the most likely triplet codons that give rise to the open reading frame for this cDNA sequence. • 5’ATGATGTTCCATGCCATAAATTAATTAATTTGCCACCATG GAA ATG ATT GCA TCA TGATATCTTTTATATATAATAAATGATGAT • GTTCCCGGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA3’ • C) (6pts) These two cDNAs come from a TWO exon gene. Draw that exon structure on the line below. • The only portions in common are the boxes with horizontal lines and their 5’UTR sequences. Gcap pA tail Kozak seq PolyA tail Two possible answers D) (3pts) Please provide a simple definition for a WT gene.___most common sequence____________________ E) (3pts) If a genotype were to be described as WT/Mutation, then this configuration is called: _heterozygous_ F) (3pts) What word generically describes a series mutations of the same gene. Alleles/polymorphisms/haplotypes G) (3pts) What is the best type of mutation to use for complementation tests? null mutation/loss of function

More Related