10 likes | 152 Vues
Quiz 2: Biol 203 2013. Lab Instructor Name:. Section: ___ Time of lab:______8 th or 9 th floor (circle). Name:_______________. This following is a depiction of an mRNA: (4pts) If possible, draw out on the line below the most likely genomic structure for the above mRNA
E N D
Quiz 2: Biol 203 2013 Lab Instructor Name: Section: ___ Time of lab:______8th or 9th floor (circle) Name:_______________ • This following is a depiction of an mRNA: • (4pts) If possible, draw out on the line below the most likely genomic structure for the above mRNA • and make sure you put the Gcap and pA tail where it belongs. • They should draw nothing or say that it is not possible to predict a “most likely” genomic structure • B) (4pts) This following sequence (two rows) represents a COMPLETE cDNA. • Please underline the most likely triplet codons that give rise to the open reading frame for this cDNA sequence. • 5’ATGATGTTCCATGCCATAAATTAATTAATTTGCCACCATG GAA ATG ATT GCA TCA TGATATCTTTTATATATAATAAATGATGAT • GTTCCCGGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA3’ • C) (6pts) These two cDNAs come from a TWO exon gene. Draw that exon structure on the line below. • The only portions in common are the boxes with horizontal lines and their 5’UTR sequences. Gcap pA tail Kozak seq PolyA tail Two possible answers D) (3pts) Please provide a simple definition for a WT gene.___most common sequence____________________ E) (3pts) If a genotype were to be described as WT/Mutation, then this configuration is called: _heterozygous_ F) (3pts) What word generically describes a series mutations of the same gene. Alleles/polymorphisms/haplotypes G) (3pts) What is the best type of mutation to use for complementation tests? null mutation/loss of function