tave
Uploaded by
36 SLIDES
668 VUES
390LIKES

Nucleic Acid Structure and Function

DESCRIPTION

Nucleic Acid Structure and Function. Structures of DNA and RNA Duplication of DNA Production of RNA and Protein. replication (S phase). transcription. translation. Information Flow From DNA. Gene: sequence of DNA that codes for a protein. DNA. (G1 and G2 phases). RNA. Protein.

1 / 36

Télécharger la présentation

Nucleic Acid Structure and Function

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Nucleic Acid Structure and Function Structures of DNA and RNA Duplication of DNA Production of RNA and Protein

  2. replication (S phase) transcription translation Information Flow From DNA Gene: sequence of DNA that codes for a protein DNA (G1 and G2 phases) RNA Protein

  3. Macromolecules: Polymers Made of Repeating Monomers

  4. base phosphate DNA and RNA Structure Nucleotide = phosphate + sugar + nitrogen-containing base

  5. NH2 C N C N HC OH CH2 CH C N N O O HO P DeoxyriboseorRibose H H O H H OH H Three Parts of Nucleotide Structure Phosphate Group NitrogenousBase (1 of 5) 5-Carbon Sugar

  6. DNA and RNA Structure OH OH OH H

  7. Turn to a partner and identify the differences between DNA and RNA structure Clarification Pause

  8. Nucleotide Chain Nucleotides are joined together by dehydration synthesis The phosphate of one nucleotide is joined to sugar of next nucleotide, forming a “sugar-phosphate backbone”

  9. T G T A C T 3’ end DNA Structure A 5’ endhas free phosphate • Two polynucleotide chains • In opposite orientations • Held together by hydrogen bonds • Twisted into a helix C G pairs with C A T G A 3’ endhas free sugar 5’ end A pairs with T

  10. Chemical Bonding

  11. A T C G

  12. Applying Your Knowledge In the DNA double helix, which base is paired with adenine? • Adenine • Cytosine • Guanine • Thymine • Uracil

  13. DNA Replication

  14. DNA Replication DNA replication is semiconservative. Each strand is used as a template to produce a new strand. AGCTAGCTAGCT  AGCTAGCTAGCT old AGCTAGCTAGCTTCGATCGATCGA TCGATCGATCGA new AGCTAGCTAGCT new TCGATCGATCGA  TCGATCGATCGA old

  15. DNA Replication DNA replication requires 1. Enzymes, including DNA polymerase that adds nucleotides in a 5’3’ direction. 2. nucleotides 3. energy 5’—A G C T — 3’ 3’— T C G A — 5’ 5’— A G C T— 3’ 3’—T C G A — 5’

  16. Outcome of DNA Replication

  17. After DNA replication, what is the composition of the new double-helical molecules? Two new chains Two old chains One old and one new chain One helix has two new chains and one has two old chains None of these is correct. Applying Your Knowledge

  18. Transcription = Production of RNA Using DNA as a Template • DNA chains separate • ONE DNA chain is used as a pattern to produce an RNA chain • RNA chain is released and the DNA chains reform the double-helix In DNA In RNAA U T A G C C G

  19. 3’---TACAAA GAGACT---5’ DNA template 5’---ATG TTTCTC TGA---3’ Transcription Transcription requires 1. Enzymes, including RNA polymerase that adds nucleotides in a 5’3’ direction. 2. nucleotides 3. energy 3’---TACAAAGAGACT---5’ 5’---ATG TTTCTC TGA---3’ 5’---AUGUUUCUCUGA---3’ mRNA

  20. Applying Your Knowledge What is the sequence of an RNA molecule transcribed from a DNA template strand that reads 3’-ATG-5’? • 5’-TAC-3’ • 5’-CAU-3’ • 5’-AUG-3’ • 5’-UAC-3’ • 3’-TAC-5’

  21. Products of Transcription • Messenger RNA Contains the code words for the sequence of amino acids in a specific protein CODON = group of three nucleotides acting as a code word for an amino acid

  22. In mRNA In tRNAA U U A G C C G mRNA Products of Transcription • Transfer RNA “Translates” the message by bringing a specific amino acid into the correct position on the growing protein chain Has ANTICODON = a group of three nucleotides on a tRNA that recognizes a mRNA codon Has amino acid attachment site

  23. Genetic Code Chart is written as a CODON dictionary, reading 5’3’

  24. for tRNA for tRNA small ribosomal subunit mRNA binding site Products of Transcription • Ribosomal RNA One of the structural components of the ribosome Ribosome = organelle where protein synthesis occurs Has sites to bind both mRNA and tRNA

  25. Applying Your Knowledge Which molecule contains the information for assembling the amino acids in the correct order in the protein? • rRNA • tRNA • mRNA • All of these • None of these

  26. Translation At the ribosome, codons in mRNA are recognized by tRNA anticodons to place amino acids in the specific sequence specified by the DNA. Three Stages of Translation: Initiation- assemble components to start process Elongation- add amino acids in repeated cycles Termination- release protein product

  27. Translation Initiation mRNA binds to ribosome First tRNA binds to mRNA met UAC 5’---AUGUUUCUCUGA---3’ mRNA

  28. Translation Elongation Next tRNA binds to mRNA met phe UAC AAA 5’---AUGUUUCUCUGA---3’ mRNA

  29. Translation Elongation Amino acids are joined First tRNA is released met phe UAC AAA 5’---AUGUUUCUCUGA---3’ mRNA

  30. Translation Elongation Ribosome moves by one codon met phe UAC AAA 5’---AUGUUUCUCUGA---3’ mRNA

  31. Translation Elongation (second cycle) Next tRNA binds to mRNA met phe leu UAC AAA GAG 5’---AUGUUUCUCUGA---3’ mRNA

  32. Translation Elongation (second cycle) Amino acids are joined Second tRNA is released met phe leu UAC GAG 5’---AUGUUUCUCUGA---3’ mRNA AAA

  33. Translation Elongation (second cycle) Ribosome moves by one codon met phe leu UAC GAG 5’---AUGUUUCUCUGA---3’ mRNA AAA

  34. Translation Termination Termination factor binds to stop codon met phe leu UAC T GAG 5’---AUGUUUCUCUGA---3’ mRNA AAA

  35. Translation Termination Protein chain is released Other components separate met phe leu UAC T GAG AAA 5’---AUGUUUCUCUGA---3’ mRNA

  36. Applying Your Knowledge If the mRNA sequence for codons 5, 6, and 7 of a protein is 5’-AAG-AUU-GGA-3’, what is the amino acid sequence in the protein? • Gly-ile-lys • Arg-leu-glu • Glu-leu-arg • Asn-met-gly • Lys-ile-gly

More Related