70 likes | 84 Vues
Explore the molecular genetics of pathogenicity islands and Shiga toxin-encoding phages, and discover available tools and strategies to find PCR primers.
E N D
Welcome to Phage sequences in bacterial genomesSearching for PCR primersThursday, 23 June 2005 • Meghan Feltcher presents: Molecular genetics of SaPI1 - a mobile pathogenicity island in Staphylococcus aureus. Ruzin A, Lindsay J, Novick RP (2001). Molec Microbiol 41:365-377. • James Kokorelis presents: Diversity and host range of Shiga toxin-encoding phage. Shantini et al (2004). Infect Immun 72:7131-7139. • Available tools to find primers in EDL933 • Strategy
Welcome to Phage sequences in bacterial genomesSearching for PCR primersThursday, 23 June 2005 • Meghan Feltcher presents: Molecular genetics of SaPI1… • James Kokorelis presents: Diversity and host range… • Available tools to find primers in EDL933 • Strategy to find primers • Do it
Strategy to find primers L0121 from bacteriophage 933W L0121 deletion derivative Kanamycin-resistance cassette GCCCGTAAAAAAGTGTTTAACGGAGGTGGAGTGTGA GGAGATAAAGGGGACACGGGGCCAGCAGGTCCGGCTA
Overview of SolutionFind primer candidates in tail fiber genes • Tail fiber gene, L0121 (E. coli O157:H7 EDL933 = EDL933) • Multiple copies of L0121 • Find copies in EDL933 • Align sequences of copies • Find long regions (20 nt) of identity • In copies, but not L0121(left primer) • In L0121, but not copies (right primer)
Useful Tools • EDL933.chromosome (sequence of chromosome)(GET-ELEMENT 35259 TO 35998 FROM EDL933.chromosome) • EDL933-genes (all gene names and sequences) (BLASTN L0121 EDL933-genes) • EDL933 (table of information about each gene) (VALUE-OF EDL933("Z0034" DESCRIPTION))