1 / 7

Phage Sequences for PCR Primers in Bacterial Genomes

Explore the molecular genetics of pathogenicity islands and Shiga toxin-encoding phages, and discover available tools and strategies to find PCR primers.

ttiffany
Télécharger la présentation

Phage Sequences for PCR Primers in Bacterial Genomes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Welcome to Phage sequences in bacterial genomesSearching for PCR primersThursday, 23 June 2005 • Meghan Feltcher presents: Molecular genetics of SaPI1 - a mobile pathogenicity island in Staphylococcus aureus. Ruzin A, Lindsay J, Novick RP (2001). Molec Microbiol 41:365-377. • James Kokorelis presents: Diversity and host range of Shiga toxin-encoding phage. Shantini et al (2004). Infect Immun 72:7131-7139. • Available tools to find primers in EDL933 • Strategy

  2. Welcome to Phage sequences in bacterial genomesSearching for PCR primersThursday, 23 June 2005 • Meghan Feltcher presents: Molecular genetics of SaPI1… • James Kokorelis presents: Diversity and host range… • Available tools to find primers in EDL933 • Strategy to find primers • Do it

  3. Strategy to find primers L0121 from bacteriophage 933W L0121 deletion derivative Kanamycin-resistance cassette GCCCGTAAAAAAGTGTTTAACGGAGGTGGAGTGTGA GGAGATAAAGGGGACACGGGGCCAGCAGGTCCGGCTA

  4. Strategy to find primers

  5. Overview of SolutionFind primer candidates in tail fiber genes • Tail fiber gene, L0121 (E. coli O157:H7 EDL933 = EDL933) • Multiple copies of L0121 • Find copies in EDL933 • Align sequences of copies • Find long regions (20 nt) of identity • In copies, but not L0121(left primer) • In L0121, but not copies (right primer)

  6. Useful Tools • EDL933.chromosome (sequence of chromosome)(GET-ELEMENT 35259 TO 35998 FROM EDL933.chromosome) • EDL933-genes (all gene names and sequences) (BLASTN L0121 EDL933-genes) • EDL933 (table of information about each gene) (VALUE-OF EDL933("Z0034" DESCRIPTION))

More Related