crwys
Uploaded by
45 SLIDES
576 VUES
450LIKES

Understanding Gene Recognition: The Central Dogma and Gene Finding Techniques

DESCRIPTION

This presentation delves into the fundamental concepts of gene recognition, focusing on the Central Dogma of molecular biology—DNA transcription, RNA translation, and protein synthesis. It explores gene structures, including exons and introns, the significance of start and stop codons, and the challenges of identifying genes within genomes, especially in organisms like yeast and humans. Emphasis is placed on methods such as Open Reading Frame (ORF) scanning, biological signals, and Hidden Markov Models for effective gene finding, highlighting the intricacies of genetic coding and conservation patterns.

1 / 45

Télécharger la présentation

Understanding Gene Recognition: The Central Dogma and Gene Finding Techniques

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Gene Recognition Credits for slides: Serafim Batzoglou Marina Alexandersson Lior Pachter Serge Saxonov

  2. DNA transcription RNA translation Protein The Central Dogma CCTGAGCCAACTATTGATGAA CCUGAGCCAACUAUUGAUGAA PEPTIDE

  3. Gene structure intron1 intron2 exon2 exon3 exon1 transcription splicing translation Codon: A triplet of nucleotides that is converted to one amino acid exon = protein-coding intron = non-coding

  4. Locating Genes • We have a genome sequence, maybe with related genomes aligned to it…where are the genes? • Yeast genome is about 70% protein coding • About 6000 genes • Human genome is about 1.5% protein coding • About 22,000 genes

  5. Stop codon TAG/TGA/TAA Start codon ATG Finding Genes in Yeast Coding Intergenic Intergenic 5’ 3’ Mean coding length about 1500bp (500 codons) Transcript

  6. Finding Genes in Yeast • ORF Scanning • Look for long open reading frames (ORFs) • ORFs start with ATG and contain no in-frame stop codons • Long ORFs unlikely to occur by chance (i.e., they are probably genes)

  7. Finding Genes in Yeast Yeast ORF distribution

  8. Stop codon TAG/TGA/TAA Start codon ATG Introns: The Bane of ORF Scanning Intergenic Intergenic Intron 5’ Exon Exon Intron Exon 3’ Splice sites Transcript

  9. Introns: The Bane of ORF Scanning • Drosophila: • 3.4 introns per gene on average • mean intron length 475, mean exon length 397 • Human: • 8.8 introns per gene on average • mean intron length 4400, mean exon length 165 • ORF scanning is defeated

  10. Where are the genes?

  11. Needles in a Haystack

  12. Now What? • We need to use more information to help recognize genes • Regular structure • Exon/intron lengths • Nucleotide composition • Biological signals • Start codon, stop codon, splice sites • Patterns of conservation

  13. Regular Gene Structure • Protein coding region starts with ATG, ends with TAA/TAG/TGA • Exons alternate with introns • Introns start with GT/GC, end with AG • Each exon has a reading frame determined by the codon position at the end of the last exon

  14. Next Exon: Frame 0 Next Exon: Frame 1

  15. Exon/Intron Lengths

  16. Nucleotide Composition • Base composition in exons is characteristic due to the genetic code Amino Acid SLCDNA Codons Isoleucine I ATT, ATC, ATA Leucine L CTT, CTC, CTA, CTG, TTA, TTG Valine V GTT, GTC, GTA, GTG Phenylalanine F TTT, TTC Methionine M ATG Cysteine C TGT, TGC Alanine A GCT, GCC, GCA, GCG Glycine G GGT, GGC, GGA, GGG Proline P CCT, CCC, CCA, CCG Threonine T ACT, ACC, ACA, ACG Serine S TCT, TCC, TCA, TCG, AGT, AGC Tyrosine Y TAT, TAC Tryptophan W TGG Glutamine Q CAA, CAG Asparagine N AAT, AAC Histidine H CAT, CAC Glutamic acid E GAA, GAG Aspartic acid D GAT, GAC Lysine K AAA, AAG Arginine R CGT, CGC, CGA, CGG, AGA, AGG

  17. Biological Signals • How does the cell recognize start/stop codons and splice sites? • In part, from characteristic base composition • Donor site (start of intron) is recognized by a section of U1 snRNA U1 snRNA: GUCCAUUCA Donor site consensus: MAGGTRAGT M means “A or C”, R means “A or G”

  18. atg caggtg ggtgag cagatg ggtgag cagttg ggtgag caggcc ggtgag tga

  19. Donor site 5’ 3’ Splice Sites Position % -8 … -2 -1 0 1 2 … 17 A 26 … 60 9 0 0 54 … 21 C 26 … 15 5 0 1 2 … 27 G 25 … 12 78 100 0 41 … 27 T 23 … 13 8 0 99 3 … 25

  20. Splice Sites (http://www-lmmb.ncifcrf.gov/~toms/sequencelogo.html)

  21. Splice Sites • WMM: weight matrix model = PSSM (Staden 1984) • WAM: weight array model = 1st order Markov (Zhang & Marr 1993) • MDD: maximal dependence decomposition (Burge & Karlin 1997) • Decision-tree algorithm to take pairwise dependencies into account • For each position I, calculate Si = ji2(Ci, Xj) • Choose i* such that Si* is maximal and partition into two subsets, until • No significant dependencies left, or • Not enough sequences in subset • Train separate WMM models for each subset G5G-1 G5G-1 A2 G5G-1 A2U6 G5 All donor splice sites not G5 G5 not G-1 G5G-1 not A2 G5G-1A2 not U6

  22. Patterns of Conservation • Functional sequences are much more conserved than nonfunctional sequences • Signal sequences show compensatory mutations • If one position mutates away from consensus, often a different one will mutate to consensus • Coding sequence shows three-periodic pattern of conservation

  23. Three Periodicity • Most amino acids can be coded for by more than one DNA triplet • Usually, the degeneracy is in the last position Human CCTGTT (Proline, Valine) Mouse CCAGTC (Proline, Valine) Rat CCAGTC (Proline, Valine) Dog CCGGTA (Proline, Valine) Chicken CCCGTG (Proline, Valine)

  24. Intron Exon Exon Intron Intergenic Exon Intergenic Hidden Markov Models for Gene Finding First Exon State Intron State Intergene State GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA

  25. Intron Exon Exon Intron Intergenic Exon Intergenic Hidden Markov Models for Gene Finding First Exon State Intron State Intergene State GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA

  26. GENSCAN

  27. GENSCAN • Burge and Karlin, Stanford, 1997 • Before The Human Genome Project • No alignments available • Estimated human gene count was 100,000 • Explicit state duration HMM (with tricks) • Intergenic and intronic regions have geometric length distribution • Exons are only possible when correct flanking sequences are present

  28. GENSCAN • Output probabilities for NC and CDS depend on previous 5 bases (5th-order) • P(Xi | Xi-1, Xi-2, Xi-3, Xi-4, Xi-5) • Each CDS frame has its own model • WAM models for start/stop codons and acceptor sites • MDD model for donor sites • Separate parameters for regions of different GC content

  29. GENSCAN Performance • First program to do well on realistic sequences • Long, multiple genes in both orientations • Pretty good sensitivity, poor specificity • 70% exon Sn, 40% exon Sp • Not enough exons per gene • Was the best gene predictor for about 4 years

  30. TWINSCAN • Korf, Flicek, Duan, Brent, Washington University in St. Louis, 2001 • Uses an informant sequence to help predict genes • For human, informant is normally mouse • Informant sequence consists of three characters • Match: | • Mismatch: : • Unaligned: . • Informant sequence assumed independent of target sequence

  31. The TWINSCAN Model • Just like GENSCAN, except adds models for conservation sequence • 5th-order models for CDS and NC, 2nd-order models for start and stop codons and splice sites • One CDS model for all frames • Many informants tried, but mouse seems to be at the “sweet spot”

  32. TWINSCAN Performance • Slightly more sensitive than GENSCAN, much more specific • Exon sensitivity/specificity about 75% • Much better at the gene level • Most genes are mostly right, about 25% exactly right • Was the best gene predictor for about 4 years

  33. N-SCAN • Gross and Brent, Washington University in St. Louis, 2005 • If one informant sequence is good, let’s try more! • Also several other improvements on TWINSCAN

  34. N-SCAN Improvements • Multiple informants • Richer models of sequence evolution • Frame-specific CDS conservation model • Conserved noncoding sequence model • 5’ UTR structure model

  35. HMM Outputs • GENSCAN • TWINSCAN • N-SCAN Target GGTGAGGTGACCAAGAACGTGTTGACAGTA Target GGTGAGGTGACCAAGAACGTGTTGACAGTA Conservation |||:||:||:|||||:||||||||...... sequence Target GGTGAGGTGACCAAGAACGTGTTGACAGTA Informant1 GGTCAGC___CCAAGAACGTGTAG...... Informant2 GATCAGC___CCAAGAACGTGTAG...... Informant3 GGTGAGCTGACCAAGATCGTGTTGACACAA ...

  36. Phylogenetic Bayesian Network Models

  37. Homology-Based Gene Prediction • Idea: Try to predict a gene in one organism using a known orthologous gene or protein from another organism • Genewise • Protein homology • Projector • Gene structure homology • Very accurate if (and only if??) homology is high

  38. Evaluating Performance • Three main levels of performance: gene, exon, nucleotide • Two measures of performance: • Sensitivity: what fraction of the true features did we predict correctly? • Specificity: what fraction of our predicted features were correct? • Testing standard is whole-genome prediction • Predicting on single-gene sequences is easier and less interesting

  39. Exact Exon Accuracy

  40. Exact Gene Accuracy

  41. Intron Sensitivity By Length

  42. Human Informant Effectiveness

  43. Drosophila Informant Effectiveness

  44. The Future • Many new genomes being sequenced—they will need annotations! • Current experimental “shotgun” methods not enough • However, cheap targeted experiments are available to verify predicted genes • Promising directions in gene prediction: • Conditional random fields • Multiple informants—can we actually get them to work???

More Related