1 / 24

Demystifying Protein Synthesis: From Gene to Protein

Unravel the complex process of protein synthesis, from DNA to mRNA to protein, and understand how genes create proteins in the cell. Explore the role of ribosomes, mRNA, and tRNA in decoding DNA instructions. Learn about transcription and translation, the key steps in building proteins. Discover how genetic traits are passed on and delve into the fascinating world of molecular biology.

eharper
Télécharger la présentation

Demystifying Protein Synthesis: From Gene to Protein

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Protein Synthesis Making Proteins

  2. Cell organization • DNA • DNA is in the nucleus • genes = instructions for making proteins • want to keep it there = protected in the nucleus • “locked in the vault” cytoplasm nucleus

  3. nucleus Cell organization • Proteins • chains of amino acids • made by a “protein factory” or ribosome in cytoplasm • Rough ER protein for export, free ribosome Protein for cell • protein factory = ribosome cytoplasm buildproteins ribosome

  4. nucleus Passing on DNA information • Need to get DNA gene information from nucleus to cytoplasm • need a copy of DNA • messenger RNA (mRNA) is made from DNA • mRNA can leave the nucleus cytoplasm buildproteins mRNA ribosome

  5. RNA Translation: Protein Synthesis • http://www.biologyjunction.com/ANIMPROT.htm

  6. From nucleus to cytoplasm transcription Ribosome protein DNA mRNA translation trait nucleus cytoplasm

  7. DNA deoxyribose sugar nitrogen bases G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded DNA vs. RNA

  8. Transcription • Making mRNA from DNA • DNA strand is the template (pattern) • pairing bases • U : A • G : C • Enzyme • RNA polymerase

  9. Pairing bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

  10. Pairing bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

  11. RNA polymerase Pairing bases of DNA & RNA A • Pair RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U A G C C A T G G T A C A G C T A G T C A T C G T A C C G T

  12. ribosome A C C A U G U C G A U C A G U A G C A U G G C A Pairing bases of DNA & RNA • U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA

  13. ribosome A C C A U G U C G A U C A G U A G C A U G G C A cytoplasm protein nucleus trait

  14. mRNA A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa aa aa aa aa aa How does mRNA code for proteins • mRNA leaves nucleus • mRNA goes to ribosomes in cytoplasm • Proteins built from instructions on mRNA

  15. ribosome TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? aa aa aa aa aa aa aa aa How does mRNA code for proteins? How can you code for 20 amino acids withonly 4 DNA bases (A,U,G,C)?

  16. ribosome TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg ValAsnAlaCys Ala protein ? mRNA codes for proteins in triplets • Codon = block of 3 mRNA bases

  17. The mRNA code • For ALL life! • strongest support for a common origin for all life • Code has duplicates • several codons for each amino acid • mutation insurance! • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  18. GCA CAU UAC tRNA Met Arg Val How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA mRNA AUGCGUGUAAAUGCAUGCGCC codon anti-codon aminoacid • Anti-codon = block of 3 tRNA bases

  19. ribosome mRNA A C C A U G U C G A U C A G U A G C A U G G C A U A C G G U tRNA tRNA A G aa U A G tRNA aa aa aa tRNA aa aa mRNA to protein = Translation • The working instructions  mRNA • The reader  ribosome • The transporter  transfer RNA (tRNA) C

  20. aa ribosome aa aa aa A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa _______ aa From gene to RNA to protein _____________ _________________ ______________ __________ ______ ______ _____________ trait

  21. aa ribosome aa aa aa A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa tRNA aa From gene to RNA to protein cytoplasm transcription translation protein DNA mRNA trait nucleus

  22. cytoplasm protein transcription translation nucleus trait

  23. From gene to protein protein transcription translation

More Related