Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Supplementary figure 3 PowerPoint Presentation
Download Presentation
Supplementary figure 3

Supplementary figure 3

65 Vues Download Presentation
Télécharger la présentation

Supplementary figure 3

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. 1 2 3 4 5 6 M M 1 2 Probe: Unc5b 7 kb 28 s RNA Supplementary figure 3 a Specificity of the Unc5b splicing morpholino. RT-PCR reaction products from untreated embryos (1), buffer-injected embryos (2), embryos injected with 2ng (3), 4ng (4) and 6ng (5) of Unc5b morpholino and standard control- injected embryos at 28 hpf (6). The amount of the properly spliced product of 509 bp is reduced in the presence of increasing concentrations of Unc5b morpholino. M: molecular weight marker. For Unc5b and Netrin-1a knockdowns, the following morpholinos were used: Netrin-1a (to block translation of Netrin-1a mRNA, complementary to bases –8 to –32 of Netrin-1a 5’UTR): 5’–CGCCTTCCTCAGCCTCTCCTGTGCT-3’ Unc5b (to prevent correct splicing of the exon encoded by nucleotides 1-215 of the Unc5b 1.4 kb cDNA): 5’–CATTTAACCGGCTCGTACCTGCATG-3’ Standard control (general negative control, not gene specific): 5’–CCTCTTACCTCAGTTACAATTTATA-3’ b Northern blot analysis of Unc5b mRNA expression in HUAEC and HUVEC. Northern blot prepared from 20ug total RNA isolated from HUAEC (1) and HUVEC (2) was hybridized with a 1156 bp human Unc5b cDNA fragment encompassing 609 bp of coding region and 547 bp of 3’UTR. Ethidium bromide staining to control for equal loading is shown below. For RT-PCR expression studies in HUAEC or HUVEC we used the following primer sets: Unc5a: AGCTGTCCCTTAATGCTGGT/AAGGCTGTGTACATAAGGCC, Unc5b: ACTGGATCTTTCAGCTCAAG/AGTAATTCAGGTACCGGTCC, Unc5c: ATTTGCCGCTGCTGGATCCT/ACAACAAACCGTCCACAGCT, Unc5d: GCCTCGAGTACTTGGTAAGT/TGTGTCATTCTCTGTAGGCC, Dcc: AACACTCTCAGTGGACCGAG/TCCTTAACTGAGTGGTCCTG, A2b: CTATGCTTACCGGAACCGAG/ACCATGCCCGGCCGAATAAT, ß-tubulin: GCTTCAAGGTTGGCATCAAC/TAGTATTCCTCTCCTTCTTC.