1 / 1

Unc5b Splicing Morpholino Study in Embryos and Human Endothelial Cells

Investigating the effects of Unc5b morpholino on splicing in embryos and mRNA expression in human endothelial cells through RT-PCR, Northern blot, and primer sets.

jett
Télécharger la présentation

Unc5b Splicing Morpholino Study in Embryos and Human Endothelial Cells

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. 1 2 3 4 5 6 M M 1 2 Probe: Unc5b 7 kb 28 s RNA Supplementary figure 3 a Specificity of the Unc5b splicing morpholino. RT-PCR reaction products from untreated embryos (1), buffer-injected embryos (2), embryos injected with 2ng (3), 4ng (4) and 6ng (5) of Unc5b morpholino and standard control- injected embryos at 28 hpf (6). The amount of the properly spliced product of 509 bp is reduced in the presence of increasing concentrations of Unc5b morpholino. M: molecular weight marker. For Unc5b and Netrin-1a knockdowns, the following morpholinos were used: Netrin-1a (to block translation of Netrin-1a mRNA, complementary to bases –8 to –32 of Netrin-1a 5’UTR): 5’–CGCCTTCCTCAGCCTCTCCTGTGCT-3’ Unc5b (to prevent correct splicing of the exon encoded by nucleotides 1-215 of the Unc5b 1.4 kb cDNA): 5’–CATTTAACCGGCTCGTACCTGCATG-3’ Standard control (general negative control, not gene specific): 5’–CCTCTTACCTCAGTTACAATTTATA-3’ b Northern blot analysis of Unc5b mRNA expression in HUAEC and HUVEC. Northern blot prepared from 20ug total RNA isolated from HUAEC (1) and HUVEC (2) was hybridized with a 1156 bp human Unc5b cDNA fragment encompassing 609 bp of coding region and 547 bp of 3’UTR. Ethidium bromide staining to control for equal loading is shown below. For RT-PCR expression studies in HUAEC or HUVEC we used the following primer sets: Unc5a: AGCTGTCCCTTAATGCTGGT/AAGGCTGTGTACATAAGGCC, Unc5b: ACTGGATCTTTCAGCTCAAG/AGTAATTCAGGTACCGGTCC, Unc5c: ATTTGCCGCTGCTGGATCCT/ACAACAAACCGTCCACAGCT, Unc5d: GCCTCGAGTACTTGGTAAGT/TGTGTCATTCTCTGTAGGCC, Dcc: AACACTCTCAGTGGACCGAG/TCCTTAACTGAGTGGTCCTG, A2b: CTATGCTTACCGGAACCGAG/ACCATGCCCGGCCGAATAAT, ß-tubulin: GCTTCAAGGTTGGCATCAAC/TAGTATTCCTCTCCTTCTTC.

More Related