kimn
Uploaded by
57 SLIDES
2186 VUES
670LIKES

Recombinant DNA Technology

DESCRIPTION

Recombinant DNA Technology. rDNA Technology. Restriction Enzymes and DNA Ligase Plasmid Cloning Vectors Transformation of Bacteria Blotting Techniques. Restriction Enzymes. Most significant advancement permitting rDNA manipulation Differ from other nucleases

1 / 57

Télécharger la présentation

Recombinant DNA Technology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Recombinant DNA Technology

  2. rDNA Technology • Restriction Enzymes and DNA Ligase • Plasmid Cloning Vectors • Transformation of Bacteria • Blotting Techniques

  3. Restriction Enzymes • Most significant advancement permitting rDNA manipulation • Differ from other nucleases • recognize and cleave a specific DNA sequence (Type II restriction enzymes)

  4. Restriction Enzymes • Nomenclature • EcoRI • E = Escherichia genus name • co = coli species name • R = strain RY12 strain or serotype • I = Roman numeral one = first enzyme • HinDIII • Haemophilus influenza serotype d 3rd enzyme

  5. Restriction Enzymes • Recognition sites • Generally 4, 6, or 8 bp in length • Most sites are palindromic • OTTO / HANNAH / REGAL LAGER • A MAN A PLAN A CANAL PANAMA • For REases - sequence reads the same in a 5’--->3’ direction on each strand

  6. Restriction Enzymes • EcoRI 5’ GAATTC 3’ 3’ CTTAAG 5’ • Hind III 5’ AAGCTT 3’ 3’ TTCGAA 5’

  7. Restriction Enzymes • Cleave DNA to generate different “ends” • Staggered cut • 5’ extension • 3’ extension • Blunt end

  8. Staggered Cut / 5’ or 3’ Extension Eco RI 5’G AATTC CTTAA G 5’GAATTC CTTAAG + Pst I 5’ CTGCA G G ACGTC 5’ CTGCAG GACGTC +

  9. Restriction Enzymes in DNA Cloning • How are REases used ? • Ends are “sticky” • Complementary • Any two DNAs cut with same enzyme can stick together through complementary base pairing

  10. Annealing sticky ends

  11. Annealing Sticky ends DNA strands held together only by basepairing Nicks in strands need to be repaired

  12. Linking Restriction Fragments • T4 DNA Ligase • repairs nicks in DNA strands (reforms phosphodiester bond) • uses energy from ATP • works on blunt or sticky ends • Other enzymes used in rDNA technology

  13. T4 DNA Ligase Mode of Action

  14. rDNA Technology • Restriction Enzymes and DNA Ligase • Plasmid Cloning Vectors • Transformation of Bacteria • Creating and Screening Genomic Libraries • cDNA Library Construction • Vectors for Cloning Large Pieces of DNA • Blotting Techniques

  15. Recombinant DNA Cloning Procedure

  16. Recombinant DNA Cloning Procedure 1) Enzymatic digestion

  17. Recombinant DNA Cloning Procedure 2) Ligation of Target and vector DNA Ligase

  18. Recombinant DNA Cloning Procedure 3) Transform Ligated DNA into Bacteria

  19. Plasmid Cloning Vectors • Recombinant DNA needs to be replicated in bacterial cell • Self-replicating piece of DNA • termed cloning vehicle • can be plasmid or phage

  20. Plasmid Cloning Vectors • Small circular piece of DNA • Exists separate from chromosome • Derived from naturally occurring plasmids • High copy number = 10-100 copies / cell • Low copy number = 1-4 copies / cell

  21. Plasmid Cloning Vectors • Derived from naturally occurring plasmids • Altered features • small size (removal of non-essential DNA) • higher transformation efficiency • unique restriction enzyme sites • one or more selectable markers • origin of replication (retained from original plasmid) • other features: promoters, etc.

  22. pBR322old-style general purpose plasmid 4362 bp

  23. pUC19 2.68kbp

  24. Multiple Cloning Sequence (Polylinker) EcoRI KpnI BamHI Sal I GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGAC SacI SmaI XbaI Part of MCS of pUC19 and other plasmids

  25. promoter Gene Plasmid Cloning Vehicles Some plasmids (Expression Plasmids) have promoters upstream of cloning sites for expression of genetic info encoded by DNA fragment

  26. promoter Gene Shuttle Plasmid Cloning Vehicles Some plasmids (Shuttle Plasmids) have origins of replication for E. coli and another organism: yeast, mammalian cells or other bacteria E. coli ori yeast ori mammalian ori

  27. Plasmid Cloning Vehicles • What prevents plasmid DNA from reforming during ligation?

  28. Plasmid Cloning Vehicles • What prevents plasmid DNA from reforming during ligation and transforming cells as do the recombinant molecules? • Three ways to prevent • Treat with Alkaline Phosphatase • Directional Cloning • Suicide Plasmids with ccdB gene

  29. Plasmid Cloning Vehicles • Alkaline Phosphatase • removes 5’ PO4 from end of DNA strand • prevents formation of new phosphodiester bond by DNA Ligase

  30. Alkaline Phosphatase Action

  31. Alkaline Phosphatase Action Two nicks remain Will be repaired in bacterial cell follow- ing transformation

  32. Directional Cloning • Digest plasmid and target DNA with two different restriction enzymes • Hind III and BamHI • Ends are not compatible (can’t basepair) • Plasmid won’t re-circularize unless target DNA has inserted

  33. Transformation of Bacteria • rDNA constructed in the lab must be introduced into “host” cell • Cells must be able to take up DNA - “COMPETENT” • Growing bacteria will produce lots of copies of the DNA

  34. Transformation of Bacteria • Two basic methods to produce competent bacteria (able to take up added DNA) • Chemical competent • Electroporation

  35. Transformation of Bacteria • Chemical competent • Divalent metal ion Ca++ , required • treat cells with ice-cold CaCl2 solutions • Ca++ ions alter membrane so it is permeable to DNA

  36. Transformation of Bacteria • Electroporation • Cell/DNA mix given high voltage electric shock • 2.5kvolts, ~5msec • useful for high efficiency transformation • 109 transformants / µg of DNA

  37. Transformation of Bacteria • Both methods are very inefficient • only a few % of cells actually take up DNA • How are the transformed cells selected? • antibiotic resistance gene on plasmid • ampicilin, tetracycline, chloramphenicol, etc. • transformed cells grow; non-transformed die

  38. Immunological Screen of Library detectable product substrate reporter enzyme 2° Ab 1° Ab target protein matrix

  39. Immunological Screen master plate protein matrix cells 1 2 lyse cells bind protein transfer cells subculture cells from master plate 3 positive signal Add 1°Ab; wash 5 4 Add substrate Add 2°Ab-Enzyme wash

  40. Blotting Techniques • Several techniques for size fraction of nucleic acid fragments and proteins • Nucleic Acids • Agarose Gels • Polyacrylamide Gels - higher resolution • Proteins • SDS PAGE - denatured proteins

More Related