1 / 5

Investigating the Effects of LNA on Gene Expression Regulation

This study by Coelho et al. (2014) examines how LNA influences gene expression. It includes data on exon sequences, protein denaturation, and aggregation.

ryann
Télécharger la présentation

Investigating the Effects of LNA on Gene Expression Regulation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. MM pSPL3 MM pSPL3 800 bp 500 bp 700 bp 450 bp 600 bp 400 bp 500 bp 350 bp 400 bp 300 bp 300 bp 250 bp HeLa COS-7 Supplementary Figure S1 Coelho et al (2014)

  2. exon 9 exon 9 gtcagtctcccaggtaggatcctggggc exon 8 3’- gtccatcctaggacc - 5’ LNA1 10 nt gtcagtctcccaggtaggatcctggggc exon 8 3’- agagggtccatcctag - 5’ LNA2 5 nt Supplementary Figure S2 Coelho et al (2014)

  3. -LNA +LNA1(0.5 μM) MM 400 bp 300 bp Supplementary Figure S3 Coelho et al (2014)

  4. A p.D274Gfs*17 WT ~45 kDa ~35 kDa B C Supplementary Figure S4 Coelho et al (2014)

  5. A Denatured protein (normalized) [θ] (mdeg.cm-2.dmol-1) a b a b B T (°C) λ (nm) T (°C) C b b a Aggregated protein (normalized) Aggregated protein (normalized) a D T (°C) Time (min) Supplementary Figure S5 Coelho et al (2014)

More Related