molecular biology tools
General. mRNA copies of both prokaryotic and eukaryotic genes have long open reading frames (ORFs)Deciphering the information content in genomes is insurmountableBioinformaticians Small number of molecular biology toolsSix important molecular biology techniques. Restriction Enzyme Digestion. Isolated from bacterial cellsFunction in bacteria to defend again virusesMolecular scissors to cut DNARecognize palindromic sequences (same forward and reverse)Recognize 4 to 10 base pairs and cut p9460
molecular biology tools
E N D
Presentation Transcript
1. Molecular Biology Tools Lecture 1C
2. General mRNA copies of both prokaryotic and eukaryotic genes have long open reading frames (ORFs)
Deciphering the information content in genomes is insurmountable
Bioinformaticians
Small number of molecular biology tools
Six important molecular biology techniques
3. Restriction Enzyme Digestion Isolated from bacterial cells
Function in bacteria to defend again viruses
Molecular scissors to cut DNA
Recognize palindromic sequences (same forward and reverse)
Recognize 4 to 10 base pairs and cut phosphodiester bonds
Revolutionized molecular biology and biotechnology
Cloning, PCR, etc.
5. Restriction Mapping EcoRI
Cut the DNA at recognized site
What if it recognized 6 bps? On average how many times should this sequence occur?
Restriction Mapping
Simply cutting a DNA molecule
Gel electrophoresis to determine sizes
Generate a map
6. Restriction Mapping Linear DNA
Fragment sizes produced in each single digestion can be compared with those from double digestion.
Each single digestion produces three fragments from a linear DNA molecule. Most have two sites for each RE (n + 1)
Circular DNA is different. Number of sites cut = the number of DNA pieces (n)
8. Practice your Knowledge If we cut this plasmid with EcoRI and ran the DNA on a gel
How many fragments would we see on the gel?
What would the gel look like?
What if we cut with BamHI?
What if we cut with both BamHI and EcoRI?
9. Example exercise If we had a circular plasmid (3.4 kb) and we cut it with ApoI and EcoRI, ran the DNA on a gel, and the gel looked like this
10. Example exercise If we had this 1kb of linear DNA and we cut it with ApoI and EcoRI, ran the DNA on a gel
11. Gel Electrophoresis Digestion of DNA results in different fragments of DNA
These fragments can be separated by gel electrophoresis
Loading on gel, electric field, separate by size (large to small)
12. Blotting and Hybridization Find specific fragments on the gel
Probe complementary to your piece of DNA
13. Cloning Cloning transfer of DNA from one organism to another
Gene(s) can be cloned or amplified many times over by introducing into various cells.
15. General Steps of DNA tech Attach or splice DNA into cloning vector
Transfer insert into a host cell
Select for cells with cloning vector/DNA insert
Key tools: Restriction enzymes and DNA ligase
16. Cloning DNA inserted into vectors that allow for replication
Molecular clones
A collection of genes is known as a library
Genomic library contains copies of DNA
cDNA library contains copies of mRNA converted to DNA
17. Restriction Mapping Can use molecular biology software to predict restriction enzyme cut sites for a DNA sequence
Restriction maps for a DNA sequence can be obtained
Necessary to know where your restriction sites are to clone in a cloning vector (plasmid)
Mapping software
TACG
18. Restriction map
19. TACG Used for restriction enzyme mapping
A nucleic acid tool
Allows you to cut a nucleic acid sequence with all possible restriction endonucleases or it allows you to select specific restriction enzymes
Steps
Upload sequence in Biology workbench nucleic acid tools.
Select sequence and select TACG
You will be allowed to select parameters (see next slide for description)
21. What TACG can do Total number of hits per sequence
Lists cut sites for each sequence
Gives a linear map of sequence
22. Lets Try. Obtain part of the pBluescript file
Open it; select the sequence; copy
Open the Biology Workbench; start a new session; nucleic acid tools; add new nucleic acid sequence
Past sequence into box and give it a name (p_Bluescript); update sequence
Nucleic acid tools; select your sequence; choose TACG; accept defaults ;submit
23. DNA sequence ctgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattggagctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcgatcaa
24. PCR and Sequencing
25. Web sites to Review http://www.dnalc.org/ddnalc/resources/sangerseq.html
Watch the animation on Polymerase Chain Reaction (PCR)
Watch the 2 animations on DNA sequencing
http://www.bioweb.uwlax.edu/GenWeb/Molecular/Theory/PCR/PCR_Problems/pcr_problems.htm
Do some PCR practice problems
http://faculty.niagara.edu/mgallo/bioinformatics/Unknownpg.html
Practice deciphering sequencing gels
26. PCR Review
27. PCR Review
28. PCR Review
29. PCR Review
32. DNA Sequencing Techniques Understanding DNA comes from examining its nucleotide sequence. You can gather information on possible amino acid sequences, DNA binding sites, gene activity, etc.
Two protocols available to examine DNA sequence
Alan Maxam and Walter Gilbert method-chemical protocol
Fred Sanger (enzymatic method) or Dideoxynucleotide method- currently the method of choice
33. Dideoxynucleotide Procedure for DNA sequencing What is a dideoxynucleotide?
Human-made molecule
Lacks a hydroxyl group at both the 2 and 3 carbons of the sugar moiety (normal deoxyribonucleotide has a 3OH group)
34. Recall normal DNA replication
Nucleoside triphosphate is linked by it 5alpha phosphate goup to the 3hydroxyl group of the last nucleotide growing chain.
If dideoxynucleotide is incorporated at the end of the growing chain, DNA synthesis stops because a phosphodiester bond cannot be formed with the next incoming nucleotide.
37. Steps involved Anneal a synthetic oligonucleotide (17-24mer) to a predetermined segment
This acts as a primer sequence by providing a 3 hydroxyl group for initiation of DNA synthesis
The primed DNA sample is partitioned into four separate tubes. Each tube contains four deoxyribonucleoties, one which is radiolabelled and one of the four dideoxynucleotides.
38. Sequencing continued After DNA synthesis, each reaction tube will contain unique oligonucleotide.
DNA molecules are separated by polyacrylamide gel electrophoresis ( good for small sizes up to a single nucleotide)
Autoradiograph shows the radiolabeled DNA fragments that were produced druing the enzymatic DNA synthesis step.
Each of the four lanes on the autoradiograph corresponds to a reaction tube that contained one of the four dideoxynuclotides.
39. How is it read? As accurately as possible, the order of the bands are read from the bottom to the top of the autoradiograph (the radiolabeled fragment closes to the bottom)
Remember you are reading the complementary strand to the template strand
Normally can resolve up to 350 bands
42. Automated DNA Sequencing Minimizes manual manipulations
Dideoxynucleotide method forms the basis of automated DNA sequencing
Highly accurate can resolve 20,000 bases per hour
Sequence analysis carried out with four different fluorescent dyes (for each dideoxy)
44. Primers Synthetic oligonucleotide (oligo)
15 to 28 bases (average 22)
Single stranded
Orientation is 5 to 3
Must be reverse compliment of nucleic acid you are attempting to sequence or PCR amplify (template)
Primer must anneal
46. Using Primers PCR requires primer pairs
2 primers that can amplify the double stranded DNA
Sequencing requires 1 primer
Melting Temperature and annealing temperature
Annealing temperature chosen for a PCR depends directly on length and composition of the primer(s).
Analyze this sequence using IDT, http://www.idtdna.com/scitools/scitools.aspx
5 TAT TGT TGG CTT CCG GTA CAT 3
47. Calculating Ta Primer annealing temperature (Ta) should be about 5 degrees below the lowest melting temperature (Tm) for the primer pair
Ta too low?nonspecific binding; multiple PCR products
Ta too high?primer annealing low; low yield
Tmmelting temperature (temperature at which double stranded DNA template separates).
Tm = 4(G + C) + 2(A + T) oC.
What is the Tm for these primer pairs?
AGAGTTTGATCCTGGCTCAG
GGTTACCTTGTTACGACTT
48. Primer Design Rules Have at least 50% G/C content (not greater than 60%)
Anneal at a temperature in the range of 50-65 degrees C; maximum of 80
For PCR: forward and reverse primer should anneal at approximately the same temperature
49. 3'-ends of primer pairs should not be complementary primer dimers
primer self-complementation should be avoidedhairpins
runs of three or more Cs or Gs at the 3'-ends of primers should be avoided
50. Primer Design The design of PCR (and sequencing) primers is relatively simple from a computational point of view: just search along a sequence and find short sub-sequences that fit certain criteria.
The rules for choosing PCR primers are a rough combination of educated guesses and old fashioned trial-and-error.
51. Primer Problems primers should flank the sequence of interest
unique
multiple sequences will give multiple products
pairs of primers should not anneal to each other to form the dreaded "primer dimers"
52. PCR Primers
Flanking the region of interest in the DNA and annealing to DNA.
53. Problems
54. Primer 3 Download the following sequence into Biology Workbench:
Sequence is called Jordan IL-17, copy and paste sequence. Amplify 100 300 bp
atccacctcacacgaggcacaagtgcacccagcaccagctgatcaggacgcgcaaacatgagtccagggagagcttcatctgtgtctctgatgctgttgctgctgctgagcctggcggctacagtgaaggcagcagcgatcatccctcaaagctcagcgtgtccaaacactgaggccaaggacttcctccagaatgtgaaggtcaacctcaaagtctttaactcccttggcgcaaaagtgagctccagaaggccctcagactacctcaaccgttccacgtcaccctggactctccaccgcaatgaagaccctgatagatatccctctgtgatctgggaagctcagtgccgccaccagcgctgtgtcaatgcggagggaaagctggaccaccacatgaattctgttctcatccagcaagagatcctggtcctgaagagggagcctgagagctgccccttcactttcagggtcgagaagatgctggtgggtgtgggctgcacctgcgtggcctcgattgtccgccaggcagcctaaacagagacccgcggctgacccctaagaaacccccacgtttctcagcaaacttacttgcatttttaaaacagttcgtgctattgatt ttcagcaaggaatgtggattcagaggcagattcagaattg
55. Software for Designing Primers Primer 3
Lets try
Go to Biology WB and use NDJINN to search for in the GBBCT database for the following accession number (15183169) and import this sequence. http://workbench.sdsc.edu/
Now select the sequence and choose Primer 3
Find a pair of primers that will PCR amplify most of this sequence.
Now click here: http://www.bioquest.org/bioinformatics/module/cooper/Primer_Design/primer_design.htm
Choose primers at least 18 nucleotides long. Forward and reverse primers.