sandra_john
Uploaded by
55 SLIDES
952 VUES
550LIKES

molecular biology tools

DESCRIPTION

General. mRNA copies of both prokaryotic and eukaryotic genes have long open reading frames (ORFs)Deciphering the information content in genomes is insurmountableBioinformaticians Small number of molecular biology toolsSix important molecular biology techniques. Restriction Enzyme Digestion. Isolated from bacterial cellsFunction in bacteria to defend again virusesMolecular scissors to cut DNARecognize palindromic sequences (same forward and reverse)Recognize 4 to 10 base pairs and cut p9460

1 / 55

Télécharger la présentation

molecular biology tools

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


    1. Molecular Biology Tools Lecture 1C

    2. General mRNA copies of both prokaryotic and eukaryotic genes have long open reading frames (ORFs) Deciphering the information content in genomes is insurmountable Bioinformaticians Small number of molecular biology tools Six important molecular biology techniques

    3. Restriction Enzyme Digestion Isolated from bacterial cells Function in bacteria to defend again viruses Molecular scissors to cut DNA Recognize palindromic sequences (same forward and reverse) Recognize 4 to 10 base pairs and cut phosphodiester bonds Revolutionized molecular biology and biotechnology Cloning, PCR, etc.

    5. Restriction Mapping EcoRI Cut the DNA at recognized site What if it recognized 6 bps? On average how many times should this sequence occur? Restriction Mapping Simply cutting a DNA molecule Gel electrophoresis to determine sizes Generate a map

    6. Restriction Mapping Linear DNA Fragment sizes produced in each single digestion can be compared with those from double digestion. Each single digestion produces three fragments from a linear DNA molecule. Most have two sites for each RE (n + 1) Circular DNA is different. Number of sites cut = the number of DNA pieces (n)

    8. Practice your Knowledge If we cut this plasmid with EcoRI and ran the DNA on a gel How many fragments would we see on the gel? What would the gel look like? What if we cut with BamHI? What if we cut with both BamHI and EcoRI?

    9. Example exercise If we had a circular plasmid (3.4 kb) and we cut it with ApoI and EcoRI, ran the DNA on a gel, and the gel looked like this

    10. Example exercise If we had this 1kb of linear DNA and we cut it with ApoI and EcoRI, ran the DNA on a gel

    11. Gel Electrophoresis Digestion of DNA results in different fragments of DNA These fragments can be separated by gel electrophoresis Loading on gel, electric field, separate by size (large to small)

    12. Blotting and Hybridization Find specific fragments on the gel Probe complementary to your piece of DNA

    13. Cloning Cloning transfer of DNA from one organism to another Gene(s) can be cloned or amplified many times over by introducing into various cells.

    15. General Steps of DNA tech Attach or splice DNA into cloning vector Transfer insert into a host cell Select for cells with cloning vector/DNA insert Key tools: Restriction enzymes and DNA ligase

    16. Cloning DNA inserted into vectors that allow for replication Molecular clones A collection of genes is known as a library Genomic library contains copies of DNA cDNA library contains copies of mRNA converted to DNA

    17. Restriction Mapping Can use molecular biology software to predict restriction enzyme cut sites for a DNA sequence Restriction maps for a DNA sequence can be obtained Necessary to know where your restriction sites are to clone in a cloning vector (plasmid) Mapping software TACG

    18. Restriction map

    19. TACG Used for restriction enzyme mapping A nucleic acid tool Allows you to cut a nucleic acid sequence with all possible restriction endonucleases or it allows you to select specific restriction enzymes Steps Upload sequence in Biology workbench nucleic acid tools. Select sequence and select TACG You will be allowed to select parameters (see next slide for description)

    21. What TACG can do Total number of hits per sequence Lists cut sites for each sequence Gives a linear map of sequence

    22. Lets Try. Obtain part of the pBluescript file Open it; select the sequence; copy Open the Biology Workbench; start a new session; nucleic acid tools; add new nucleic acid sequence Past sequence into box and give it a name (p_Bluescript); update sequence Nucleic acid tools; select your sequence; choose TACG; accept defaults ;submit

    23. DNA sequence ctgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattggagctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcgatcaa

    24. PCR and Sequencing

    25. Web sites to Review http://www.dnalc.org/ddnalc/resources/sangerseq.html Watch the animation on Polymerase Chain Reaction (PCR) Watch the 2 animations on DNA sequencing http://www.bioweb.uwlax.edu/GenWeb/Molecular/Theory/PCR/PCR_Problems/pcr_problems.htm Do some PCR practice problems http://faculty.niagara.edu/mgallo/bioinformatics/Unknownpg.html Practice deciphering sequencing gels

    26. PCR Review

    27. PCR Review

    28. PCR Review

    29. PCR Review

    32. DNA Sequencing Techniques Understanding DNA comes from examining its nucleotide sequence. You can gather information on possible amino acid sequences, DNA binding sites, gene activity, etc. Two protocols available to examine DNA sequence Alan Maxam and Walter Gilbert method-chemical protocol Fred Sanger (enzymatic method) or Dideoxynucleotide method- currently the method of choice

    33. Dideoxynucleotide Procedure for DNA sequencing What is a dideoxynucleotide? Human-made molecule Lacks a hydroxyl group at both the 2 and 3 carbons of the sugar moiety (normal deoxyribonucleotide has a 3OH group)

    34. Recall normal DNA replication Nucleoside triphosphate is linked by it 5alpha phosphate goup to the 3hydroxyl group of the last nucleotide growing chain. If dideoxynucleotide is incorporated at the end of the growing chain, DNA synthesis stops because a phosphodiester bond cannot be formed with the next incoming nucleotide.

    37. Steps involved Anneal a synthetic oligonucleotide (17-24mer) to a predetermined segment This acts as a primer sequence by providing a 3 hydroxyl group for initiation of DNA synthesis The primed DNA sample is partitioned into four separate tubes. Each tube contains four deoxyribonucleoties, one which is radiolabelled and one of the four dideoxynucleotides.

    38. Sequencing continued After DNA synthesis, each reaction tube will contain unique oligonucleotide. DNA molecules are separated by polyacrylamide gel electrophoresis ( good for small sizes up to a single nucleotide) Autoradiograph shows the radiolabeled DNA fragments that were produced druing the enzymatic DNA synthesis step. Each of the four lanes on the autoradiograph corresponds to a reaction tube that contained one of the four dideoxynuclotides.

    39. How is it read? As accurately as possible, the order of the bands are read from the bottom to the top of the autoradiograph (the radiolabeled fragment closes to the bottom) Remember you are reading the complementary strand to the template strand Normally can resolve up to 350 bands

    42. Automated DNA Sequencing Minimizes manual manipulations Dideoxynucleotide method forms the basis of automated DNA sequencing Highly accurate can resolve 20,000 bases per hour Sequence analysis carried out with four different fluorescent dyes (for each dideoxy)

    44. Primers Synthetic oligonucleotide (oligo) 15 to 28 bases (average 22) Single stranded Orientation is 5 to 3 Must be reverse compliment of nucleic acid you are attempting to sequence or PCR amplify (template) Primer must anneal

    46. Using Primers PCR requires primer pairs 2 primers that can amplify the double stranded DNA Sequencing requires 1 primer Melting Temperature and annealing temperature Annealing temperature chosen for a PCR depends directly on length and composition of the primer(s). Analyze this sequence using IDT, http://www.idtdna.com/scitools/scitools.aspx 5 TAT TGT TGG CTT CCG GTA CAT 3

    47. Calculating Ta Primer annealing temperature (Ta) should be about 5 degrees below the lowest melting temperature (Tm) for the primer pair Ta too low?nonspecific binding; multiple PCR products Ta too high?primer annealing low; low yield Tmmelting temperature (temperature at which double stranded DNA template separates). Tm = 4(G + C) + 2(A + T) oC. What is the Tm for these primer pairs? AGAGTTTGATCCTGGCTCAG GGTTACCTTGTTACGACTT

    48. Primer Design Rules Have at least 50% G/C content (not greater than 60%) Anneal at a temperature in the range of 50-65 degrees C; maximum of 80 For PCR: forward and reverse primer should anneal at approximately the same temperature

    49. 3'-ends of primer pairs should not be complementary primer dimers primer self-complementation should be avoidedhairpins runs of three or more Cs or Gs at the 3'-ends of primers should be avoided

    50. Primer Design The design of PCR (and sequencing) primers is relatively simple from a computational point of view: just search along a sequence and find short sub-sequences that fit certain criteria. The rules for choosing PCR primers are a rough combination of educated guesses and old fashioned trial-and-error.

    51. Primer Problems primers should flank the sequence of interest unique multiple sequences will give multiple products pairs of primers should not anneal to each other to form the dreaded "primer dimers"

    52. PCR Primers Flanking the region of interest in the DNA and annealing to DNA.

    53. Problems

    54. Primer 3 Download the following sequence into Biology Workbench: Sequence is called Jordan IL-17, copy and paste sequence. Amplify 100 300 bp atccacctcacacgaggcacaagtgcacccagcaccagctgatcaggacgcgcaaacatgagtccagggagagcttcatctgtgtctctgatgctgttgctgctgctgagcctggcggctacagtgaaggcagcagcgatcatccctcaaagctcagcgtgtccaaacactgaggccaaggacttcctccagaatgtgaaggtcaacctcaaagtctttaactcccttggcgcaaaagtgagctccagaaggccctcagactacctcaaccgttccacgtcaccctggactctccaccgcaatgaagaccctgatagatatccctctgtgatctgggaagctcagtgccgccaccagcgctgtgtcaatgcggagggaaagctggaccaccacatgaattctgttctcatccagcaagagatcctggtcctgaagagggagcctgagagctgccccttcactttcagggtcgagaagatgctggtgggtgtgggctgcacctgcgtggcctcgattgtccgccaggcagcctaaacagagacccgcggctgacccctaagaaacccccacgtttctcagcaaacttacttgcatttttaaaacagttcgtgctattgatt ttcagcaaggaatgtggattcagaggcagattcagaattg

    55. Software for Designing Primers Primer 3 Lets try Go to Biology WB and use NDJINN to search for in the GBBCT database for the following accession number (15183169) and import this sequence. http://workbench.sdsc.edu/ Now select the sequence and choose Primer 3 Find a pair of primers that will PCR amplify most of this sequence. Now click here: http://www.bioquest.org/bioinformatics/module/cooper/Primer_Design/primer_design.htm Choose primers at least 18 nucleotides long. Forward and reverse primers.

More Related