Flashcard Warm-up
Flashcard Warm-up. Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy. My picture: My definition: Gel Electrophoresis Tool used to create a DNA fingerprint My picture: My definition: .
Flashcard Warm-up
E N D
Presentation Transcript
Flashcard Warm-up Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy. My picture: My definition: Gel Electrophoresis Tool used to create a DNA fingerprint My picture: My definition:
Unit 9Biotechnology and Genomics This is NOT a DNA fingerprint. This is a DNA fingerprint.
DNA Fingerprint • A unique band pattern of DNA fragments. • Unique to every individual, unless you have an identical twin
DNA Fingerprint • Gel Electrophoresis: • a tool used to create a DNA fingerprint; separates pieces of DNA based on size • (the number of base pairs in each piece).
DNA Fingerprint • Steps in DNA Fingerprinting • Step 1:Restriction enzyme cleaves specific DNA sequence • Restriction enzyme: the enzymes that “cuts” the DNA between the nitrogen bases • Cleave: to Cut
DNA Fingerprinting • Step 2: DNA loaded into a gel electrophoresis.. • Step 3: Bands are created as electricity forces DNA fragments through the gel. Small pieces move further than larger pieces.
Running a gel fragments of DNAseparate out based on size cut DNA with restriction enzymes Stain DNA • ethidium bromide binds to DNA • fluoresces under UV light 1 2 3
DNA Fingerprint • Uses for DNA Fingerprinting: • Violent Crimes – determines source of DNA left at a crime scene. • Paternity - used to determine the father of a child
1 2 3 4 5 1 2 3 4 5 Uses: Evolutionary relationships • Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – DNA +
Example A DNA sample was retrieved from a rape kit completed at the hospital. The police have 3 possible suspects. A DNA fingerprint has been done to narrow done the suspect pool. Who is the police’s MAIN Suspect?
Ticket out the Door 1. Why are restriction enzymes important when making a DNA fingerprint? 2. What do the bands represent on a DNA fingerprint? 3. Using the fingerprint to the right who is a possible suspect for murder?
Flashcard Warm-up Recombinant DNA/ Genetic Engineering Technology that combines DNA from two different organisms. One practical application of this process is making human insulin for people with Diabetes. Glo fish were the first genetically engineered Pet in 1993! A gene called “green fluorescent protein” was extracted from jellyfish to create the first glo fish. Their goal was to develop a fish that could detect pollution by selectively fluorescing in the presence of environmentaltoxins
Is the male in the fingerprint the father of the girl?
We have been manipulating DNA for generations! • Artificial breeding or AKA artificial selection • creating new breeds of animals & new crop plants to improve our food • A process in which humans consciously select for or against particular features in organisms. For example, the human may allow only organisms with the desired feature to reproduce or may provide more resources to the organisms with the desired feature
Breeding food plants Evolution of modern corn (right) from ancestral teosinte (left).
Most practical application of GENETIC ENGINEERING… • Creating Insulin (a protein hormone) for people with Diabetes
Genetic Engineering • Genetic Engineering: Modifications of DNA; AKA Recombinant DNA • Transgenic Organism: an organism which contains foreign DNA A gene isolated from a species of jellyfish which causes fluorescence was introduced into marmoset embryos that allows them to build green fluorescent protein (GFP) in their tissues. Which glows green when exposed to blue light.
Genetic Engineering • Process in creating Transgenic organism: • Step 1: Restriction enzymes cleave DNA sequence at desired gene (ex. Insulin
Genetic Engineering • Step 2 : The same restriction enzyme is used to cleave the vector • Vector: The structure used to carry the foreign DNA bacterial plasmids commonly used. • Plasmid: Circular DNA found in bacteria
Genetic Engineering • Step 3: Foreign DNA and Vector spliced together • Splice: Combine
Genetic Engineering • Step 4: The recombinant DNA is inserted into the host (bacteria cell). Host cell will copy and produce the protein
Genetic Engineering • Recombinant DNA: form of artificial DNA that is created by combining two different sources of DNA
transformedbacteria gene fromother organism recombinantplasmid + vector plasmid growbacteria harvest (purify)protein Grow bacteria…make more
TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATCCATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGCTAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATCCATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC “new” protein from organism ex: human insulin from bacteria aa aa aa aa aa aa aa aa aa aa How can bacteria read human DNA? Why mix genes together? • Gene produces protein in different organism or different individual human insulin gene in bacteria bacteria human insulin
Bioethical Concerns for Genetic Engineering • Should we produce artificial proteins? • Allergic reactions (adding a peanut gene to a corn plant) • Environmental problems from creating transgenic organisms • (ex. Oil digesting bacteria)
GMO’s –What are they? • GMO stands for Genetically Modified Organisms http://cls.casa.colostate.edu/transgeniccrops/animation.html
transformedbacteria gene fromother organism recombinantplasmid + vector plasmid growbacteria harvest (purify)protein Flashcard Warm-upSteps in genetic Engineering/ Recombinant DNA
Gene Therapy • Defective genes are identified and replaced with a functioning gene from another individual • Uses: replace missing of defective genes, Ex. Treating cystic fibrosis and hemophilia
Human Genome Project • The Human Genome Project: is a collaborative effort among scientists from around the world to map the genes of a human. • Uses: determine whether individuals may carry genes for genetic conditions in the hopes to develop gene therapy or genetically based medicines
Ticket out the Door • Foreign DNA is spliced into what type of organism? • What is a most common use of Recombinant DNA? • Tobacco plant displays a bioluminescence (glows) due to a protein found in fireflies which controls the fireflies luminescence. Which is the transgenic organism, Tobacco plant or the firefly? • What was the purpose of the Human Genome Project?
Recombinant DNA Ticket IN the door. A. Foreign DNA and Vector spliced together • 1. Place the lettered steps in the correct order. • 2. What organism usually acts as the host cell in the process of genetic engineering? • 3. What is a plasmid? • 4. What do hydrogen bonds hold together in a DNA molecule? B. The recombinant DNA is inserted into the host (bacteria cell). C. Restriction enzymes cleave DNA sequence at desired gene (ex. Insulin D. The same restriction enzyme is used to cleave the vector