Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Supplementary Fig.1 PowerPoint Presentation
Download Presentation
Supplementary Fig.1

Supplementary Fig.1

91 Vues Download Presentation
Télécharger la présentation

Supplementary Fig.1

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Supplementary Fig.1 The offspring of parental male EGFP mice mated with wild-type mice M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 2000 2000 1000 1000 750 750 500 500 250 250 100 100 The offspring of parental female EGFP mice mated with wild-type mice M 1 2 3 4 5 6 7 8 9 10 11 12 13

  2. Supplementary Fig.2 CAG Promoter Target Fragment FragmentBetween Targeted CAG promoter and EGFP Coding Region The Sequecing Fragment EGFP Coding Region Target Fragment CAG Promoter Coding Region CMV enhancer EGFP chicken beta-actin -99bp GGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTCGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA +720bp

  3. Supplementary Fig.3 A -352bp -302bp -252bp -202bp - 152bp -102bp -52bp -352bp GGGATTTTTTTTGTTTTAAATTTGTGCGGAGTCGAAATTTGGGAGGCGTCGTCGTATTTTTTT GGGACTTCCTTTGTCCCAAATCTGTGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTC TAGCGGGCGCGGGGCGAAGCGGTGCGGCGTCGGTAGGAAGGAAATGGGCGGGGAGGGTTTTCG TAGCGGGCGCGGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCG TGCGTCGTCGCGTCGTCGTTTTTTTTTTTTTTTTTAGTTTCGGGGTTGTTCGCGGGGGGACGG TGCGTCGCCGCGCCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGTCCGCGGGGGGACGG TTGTTTTCGGGGGGGACGGGGTAGGGCGGGGTTCGGTTTTTGGCGTGTGATCGGCGGTTTTAG CTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAG AGTTTTTGTTAATTATGTTTATGT AGCCTCTGCTAACCATGTTCATGC -76bp

  4. Supplementary Fig.4 +481bp GGTATTAAGGTGAATTTTAAGATTCGTTATAATATCGAGGACGGTAGCGTGTAGTTCGTCGAT GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGAC TATTATTAGTAGAATATTTTTATCGGCGACGGTTTCGTGTTGTTGTTCGATAATTATTATTTGAG CACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAG TATTTAGTTCGTTTTGAGTAAAGATTTTAACGAGAAGCGCGATTATATGGTTTTGTTGGAGTT CACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTT +672bp