Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
GFP PowerPoint Presentation

GFP

132 Vues Download Presentation
Télécharger la présentation

GFP

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. A B 5’-LTR U6.2 shRNA CMV GFP shRNA CONSTRUCT Scrambled GGATCCCGACGATTCGAGGCGCAGTGATTTGATATCCGATCACTGCGCCTCGAATCGTCTTTTTTCCAACTCGAG Cyp2b-KD2 GGATCCCAAGAACACTGAGGTGTACCCCTTGATATCCGGGGGTACACCTCAGTGTTCTTTTTTTTCCAACTCGAG Cyp2b-KD3 GGATCCCGCAAGACAAATGCGCTTTCCTGTTGATATCCGCAGGAAAGCGCATTTGTCTTGTTTTTTCCAACTCGAG Supplementary File 2: Short hairpin RNA (shRNA) constructs. (A) Simple linear map of the pRNAT U-6.2/lenti vector and the insertion of Cyp2b shRNA constructs. (B) Sequence of full length constructs including sense, loop, and anti-sense Cyp2b shRNA constructs. Underlined areas of the construct are the sense and anti-sense strands that recognize and target CYP mRNA for destruction. Each of the Cyp2b-KD constructs recognizes all five isoforms (genes) of the mouse Cyp2b subfamily (Cyp2b9, Cyp2b10, Cyp2b13, Cyp2b19, Cyp2b23). The scrambled shRNA was used for in vitro research and contains the same ATCG percentages as Cyp2b-KD3.