ophira
Uploaded by
46 SLIDES
605 VUES
460LIKES

Understanding Central Dogma: From DNA to RNA to Protein Translation

DESCRIPTION

This lecture covers the fundamental processes of gene expression, specifically the pathways of transcription and translation. It explains how DNA is transcribed into messenger RNA (mRNA) and how this mRNA is then translated into proteins. The talk details the triplet code used in DNA and RNA as well as the significance of codons in determining amino acids. It also highlights the one-directional flow of genetic information, the role of promoters in transcription initiation, and introduces Mendel’s concept of genes contributing to heredity.

1 / 46

Download Presentation
Télécharger la présentation

Understanding Central Dogma: From DNA to RNA to Protein Translation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Genome 351, 7April 2014, Lecture 3 Today… • The information in DNA is converted to protein through an RNA intermediate (transcription) • The information in the RNA intermediate is converted into protein (translation) • DNA & RNA use a triplet code for amino acids • A gene is a segment of DNA that specifies a protein • Promoters: start sites of transcription

  2. A T C G How does info in DNA flow to protein? The genetic material: DNA -Four subunits (bases A, C, G, T) But virtually all cellular functions are mediated by proteins -Twenty subunits (amino acids) How does this work?

  3. The RNA Tie Club -Proposed that a transient ribonucleic acid (RNA) intermediate is involved in the conversion of info from DNA to protein

  4. The “Central Dogma” messenger RNA (mRNA) deoxyribose sugar in DNA sugar-phosphate backbone ribose sugar in RNA RNA Bases includeA,C,G,U 5’ DNA Bases includeA,C,G,T ??? translation transcription DNA is double-stranded RNA is (mostly) single-stranded (G:C & A:U) 3’ RNA DNA Protein

  5. DNA replication (heredity) phenotype The “Central Dogma” transcription translation DNA mRNA Protein genotype -Information only flows one way -It’s universal (works the same way in prokaryotes & eukaryotes)

  6. mRNA promoter mRNA promoter terminator Transcription: copy gene into mRNA to make a specific protein Mendel’s units of information (genes) are particular sequences along the chromosomes. gene gene gene where trans-cription ends where transcription begins (more later) This region from chromsome 7 contains the CFTR (cystic fibrosis gene): CFTR CORTBP2 GASZ 116.9 117.1 117.3 116.7 position in human sequence (millions of bases)

  7. mRNA promoter mRNA promoter terminator Transcription: copy gene into mRNA to make a specific protein Mendel’s units of information (genes) are particular sequences along the chromosomes. gene gene gene where trans-cription ends where transcription begins (more later) This region from chromsome 7 contains the CFTR (cystic fibrosis gene): CFTR CORTBP2 GASZ 116.9 117.1 117.3 116.7 position in human sequence (millions of bases)

  8. mRNA promoter mRNA Transcription: copy gene into mRNA to make a specific protein gene promoter gene gene A G C 5’ 3’ 3’ 5’ T C G A G C 5’ 3’ 3’ 5’ G C T RNA polymerase

  9. mRNA promoter mRNA Transcription: copy gene into mRNA to make a specific protein gene gene gene promoter A G C 5’ 3’ 3’ 5’ T C G A G C 5’ 3’ C G A 3’ 5’ G C T

  10. Transcription: copy gene into mRNA to make a specific protein coding or sense strand (same sequence as mRNA) T A C 5’ 3’ C 3’ A U 3’ 5’ G T A mRNA template strand (complementary to mRNA) 5’ Where’s the 5’ end of the gene? of the mRNA? Which way is RNA polymerase moving?

  11. Transcription: copy gene into mRNA to make a specific protein I. initiation II. elongation III. termination

  12. DNA nascent RNA transcripts RNA polymerases Transcription in vivo Where (right or left) is the promoter? gene Which strand (top or bottom) is the template? Which way (right or left) are RNA polymerases moving?

  13. DNA nascent RNA transcripts RNA polymerases Transcription in vivo Where (right or left) is the promoter? gene Which strand (top or bottom) is the template? Which way (right or left) are RNA polymerases moving? 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’

  14. RNA carries the information from DNA in the nucleus to the cytoplasm Transcription DNA RNA Translation Protein

  15. But how do 4 bases encode 20 different amino acids?

  16. The Morse Code Morse code key Letters: Numbers: … --- … = SOS A lot of information can be relayed using just a 3 bit code: dots, dashes and spaces

  17. How is information coded in DNA? Translating the nucleic acid code (4 different bases) to a protein code (20 aa’s)… Possible coding systems: 1 base per amino acid Could only code for 4 amino acids! 2 bases per amino acid Could only code for 16 amino acids 3 bases per amino acid 64 possible combinations… that’s plenty!

  18. 20 different amino acids and 64 possible combinations of three bases (64 “codons”) Alanine Arginine Aspartic acid Aspargine Cysteine Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine Stop Ala Arg Asp Asn Cys GlT Gln Gly His Ile LeT Lys Met Phe Pro Ser Thr Trp Tyr Val A R D N C E Q G H I L K M F P S T W Y V * GCA, GCC, GCG, GCT AGA, AGG, CGA, CGC, CGG, CGT AAC, AAT GAC, GAT TGC, TGT GAA, GAG CAA, CAG GGA, GGC, GGG, GGT CAC, CAT ATA, ATG, ATT TTA, TTG,CTA, CTC, CTG, CTT AAA, AAG ATG TTC, TTT CCA, CCC, CCG, CCT AGC, AGT, TCA, TCC, TCG, TCT ACA,ACC, ACG, ACT TGG TAC, TAT GTA, GTC, GTG, GTT TAA, TAG, TGA There is redundancy (more than one codon) for some amino acids, but each codon specifies only one amino acid

  19. The Genetic Code Table 10.5

  20. Another type of genetic code table = stop = stop

  21. codon A U mRNA G A C 5’ 3’ U U A U A A C A G A C U C U C A M e t T h r S e r V a l T h r P h e NH3+ COO- Translation: converting the nucleic acid code to protein The triplet code 3 bases = 1 amino acid More than 1 triplet can code for the same amino acid Translation: read the information in RNA to order the amino acids in a protein protein

  22. start: AUG = methionine, the first amino acid in (almost) all proteins stop: UAA, UAG, and UGA. A U mRNA G A C 5’ 3’ U U A U A A C A G A C U C U C A STOP M e t T h r S e r V a l T h r P h e NH3+ COO- Translation: converting the nucleic acid code to protein Punctuation: protein

  23. Translation of the mRNA requires an RNA adaptor called transfer RNA (tRNA) pairs with the codon in mRNA Each codon has a specific tRNA with a complementary anticodon, linked to a specific amino acid.

  24. Met Met anticodon UAC UAC Recognizes AUG codon in mRNA 5’ AUG 3’ tRNAs ferry amino acids to the mRNA during translation amino acid 3’ “charged” tRNA transfer RNA (tRNA) aminoacyl-tRNA synthetase

  25. The ribosome: mediates translation • A large complex of ribosomal RNAs (rRNAs) & proteins make up a ribosome • Two subunits that join during protein synthesis • rRNAs Provide structural support and serve as catalysts (ribozymes) 5,080 bases of rRNA (2-3 different rRNAs) ~49 proteins 1,900 base rRNA ~33 proteins

  26. Thr Met UAC ... UGA ... Translation ribosome + met-tRNA locates the 1st AUG (from 5’ end) & sets the reading frame for codon-anticodon base-pairing ribosome mRNA …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’ After the 1st two tRNAs have bound…

  27. Thr Met UAC UGA ... Translation the ribosome breaks the Met-tRNA bond; Met is joined to the second amino acid… ribosome mRNA ... …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’

  28. Thr Met UAC UGA ... Translation the ribosome breaks the Met-tRNA bond; Met is joined to the second amino acid… the Met-tRNA is released ribosome mRNA …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’ …then ribosome moves over by 1 codon in the 3’ direction

  29. Thr Ser Met AGU ... UGA ... Translation and the next tRNA can bind, and the process repeats mRNA …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’

  30. Ser Met AGU ... Translation Thr UGA mRNA …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’

  31. Ser Met AGU ... Translation Thr mRNA …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’

  32. Met Thr Ser Val Thr Phe UAG ... STOP Translation When the ribosome reaches the Stop codon… termination …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’

  33. Met Thr Ser Val Thr Phe The finished peptide! NH3+ COO- Peptide = short protein Polypeptide = longer protein …AUAUGACUUCAGUAACCAUCUAACA… 5’ 3’

  34. Transcription and translation occur in separate compartments in eukaryotes… Transcription Translation

  35. DNA …but bacteria lack a nucleus transcription and translation take place in the same compartment mRNAs covered with ribosomes

  36. 3’ 5’ 3’ 5’ Questions DNA mRNA ribosome A B Where are the 5’ and 3’ ends of the mRNA?

  37. Questions Which strand on the DNA sequence is the coding (sense) strand? How can you tell? upper strand

  38. Questions On the DNA sequence, circle the nucleotides that correspond to the start codon.

  39. Questions How many amino acids are encoded by this gene? 13

  40. Questions Do you expect the start and stop codons of gene 2 to be represented in the DNA sequence that is shown?

  41. The form of mRNA Translation start Translation stop Non-coding Coding sequence that gets translated into protein Non-coding 5’ 3’ An mRNA starts out with non-coding sequence at the beginning, followed by a start codon, the coding sequence, a stop codon and more non-coding sequence The non-coding portion is often referred to as the ‘untranslated region’ or UTR.

  42. RNA is sometimes the active product of a gene! • tRNA -- transfer RNA • ribosomal RNA (rRNA) -- the translation apparatus) • small nuclear RNAs (snRNA) -- part of the machinery that helps splice the mRNA (more later on this) • microRNAs (miRNA) -- regulate mRNA translation

  43. Regulation of mRNA translation Animal and plant cells have two mechanisms to regulate mRNA translation. Both mechanisms involve recognizing double stranded RNA. In the first, cells transcribe short RNAs (microRNAs; miRNA) that can bind imperfectly to the UTR of mRNAs and inhibit translation. In the second, cells recognize double-stranded RNA (dsRNA) and degrade it to small fragments. These small fragments (small interfering RNA; siRNA) are then incorporated into a complex that binds to the matching mRNA and destroys it!

  44. miRNA that bind imperfectly can regulate mRNA translation Pre-miRNA Processing Binds to target mRNA mRNA Inhibits translation

  45. miRNA that bind perfectly can destroy mRNA dsRNA processing (Dicer) siRNA cleavage (Ago) bind to mRNA cleavage (RISC) mRNA

  46. siRNA siRNA (small interfering) may able to be used therapeutically to silence specific genes RISC mRNA

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer