shima
Uploaded by
1 SLIDES
104 VUES
10LIKES

Prolactin & IGFBP-1 Induction in KC02-44D Cells

DESCRIPTION

Study on Prolactin and IGFBP-1 expression using E2, MPA, and cAMP treatments in KC02-44D cells. RT-PCR analysis showed induced markers. Primer details provided.

1 / 1

Télécharger la présentation

Prolactin & IGFBP-1 Induction in KC02-44D Cells

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. E2 - + - + + + MPA - - + + + - cAMP - - - - + + Prolactin IGFBP-1 β-actin Induction of Prolactin and IGFBP-1 expression in KC02-44D cells. KC02-44D cells were treated with the indicated combinations of 10−8 M E2, 10−6 M MPA, and 0.125 mM cAMP for 6 days. Induction of transcripts for the decidualization markers prolactin and IGFBP-1 was demonstrated by RT-PCR; β-actin mRNA was amplified for normalization. Passage number 17. The primers used for amplification were as follows: Prolactin, forward primer 5′-GAGCCTGATAGTCAGCATATTG-3′ and reverse primer 5′-TGGATGTGGGCTTAGCAGTTGT-3′; IGFBP-1, forward primer 5′- GAGAGCACGGAGATAACTGAGG -3′ and reverse primer 5′- AGGGATCCTCTTCCCATTCCAAGGGTAGA -3’. Supplemental Figure S1

More Related